Incidental Mutation 'R7002:Il18r1'
ID544568
Institutional Source Beutler Lab
Gene Symbol Il18r1
Ensembl Gene ENSMUSG00000026070
Gene Nameinterleukin 18 receptor 1
SynonymsIl18ralpha, Il1rrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7002 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40465552-40500854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40474853 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 73 (S73N)
Ref Sequence ENSEMBL: ENSMUSP00000141695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000167723] [ENSMUST00000193391] [ENSMUST00000193793] [ENSMUST00000195684]
Predicted Effect probably benign
Transcript: ENSMUST00000087983
AA Change: S73N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: S73N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108044
AA Change: S73N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: S73N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167723
AA Change: S73N

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128277
Gene: ENSMUSG00000026070
AA Change: S73N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193391
AA Change: S73N

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141695
Gene: ENSMUSG00000026070
AA Change: S73N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193793
AA Change: S73N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141464
Gene: ENSMUSG00000026070
AA Change: S73N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 3.7e-3 SMART
IG_like 132 189 9.7e-3 SMART
Pfam:Ig_2 214 263 5.2e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195684
AA Change: S73N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: S73N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,941,564 S1308P probably damaging Het
Abl2 A T 1: 156,559,133 R29W probably damaging Het
Adam6b C A 12: 113,489,707 S48* probably null Het
Adamts18 T A 8: 113,775,290 D313V possibly damaging Het
Aoc1 A G 6: 48,905,876 S229G probably benign Het
Apol10a G A 15: 77,484,846 R15H possibly damaging Het
Bend4 T A 5: 67,398,259 T535S probably benign Het
Blm T C 7: 80,469,753 K1024R probably benign Het
Brca2 T C 5: 150,539,918 V1049A probably benign Het
Cerk T C 15: 86,156,594 Y188C possibly damaging Het
Cic C T 7: 25,272,196 R451C probably damaging Het
Col18a1 A T 10: 77,166,343 V10E unknown Het
Cplx1 T A 5: 108,520,316 K58M probably damaging Het
Crybg1 T A 10: 43,998,835 D759V probably damaging Het
Cwc25 A T 11: 97,748,071 N342K probably damaging Het
Dab2 A T 15: 6,435,365 T566S probably benign Het
Depdc5 G A 5: 32,877,158 probably null Het
Dip2b T A 15: 100,160,465 N408K probably benign Het
Dnah12 T C 14: 26,876,998 I3631T probably damaging Het
Dnase1 A G 16: 4,039,546 I236V possibly damaging Het
Duox1 C T 2: 122,319,877 Q196* probably null Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Erich5 C T 15: 34,471,362 L246F probably damaging Het
Frmpd1 C T 4: 45,284,200 A1007V probably benign Het
Fsip2 T A 2: 82,989,343 I5140N possibly damaging Het
Gan T C 8: 117,195,847 C440R possibly damaging Het
Garnl3 T A 2: 33,054,193 H73L possibly damaging Het
Gid8 T G 2: 180,713,303 M34R possibly damaging Het
Gjd4 C A 18: 9,280,960 L39F possibly damaging Het
Gm5868 T A 5: 72,586,420 probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grhpr T C 4: 44,990,427 S306P probably damaging Het
Hdac4 T G 1: 91,968,361 K729T possibly damaging Het
Hist2h2be A G 3: 96,221,373 I70V probably benign Het
Igfbp2 C T 1: 72,849,645 H85Y probably damaging Het
Igkv4-61 T G 6: 69,417,389 I13L probably benign Het
Immt T C 6: 71,861,040 V244A probably damaging Het
Irs1 T C 1: 82,288,260 Y745C probably benign Het
Itpr3 T C 17: 27,110,580 V1526A probably benign Het
Jrkl A T 9: 13,245,521 I45K probably damaging Het
Lamp3 G T 16: 19,655,422 Q401K possibly damaging Het
Lrrfip1 T A 1: 91,115,458 H528Q probably benign Het
Ltn1 A T 16: 87,423,473 D245E probably benign Het
Mnat1 T C 12: 73,230,705 probably benign Het
Mpp6 C T 6: 50,162,662 P116L probably benign Het
Mprip A C 11: 59,761,190 M1907L probably benign Het
Mut T A 17: 40,941,383 I272N possibly damaging Het
Nfu1 C A 6: 87,016,272 H131Q probably benign Het
Nup188 T A 2: 30,323,568 S670R probably damaging Het
Olfr1090 T C 2: 86,754,681 D19G probably benign Het
Olfr1477 A G 19: 13,502,675 N111D probably benign Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pbrm1 T A 14: 31,064,820 D631E probably benign Het
Prss40 A T 1: 34,552,400 probably null Het
Rnf13 A G 3: 57,833,612 N274S probably damaging Het
Rtl1 T A 12: 109,593,947 Y486F probably damaging Het
Sec14l3 A T 11: 4,075,263 H291L possibly damaging Het
Senp5 A G 16: 31,983,775 S532P probably damaging Het
Sepsecs T C 5: 52,647,208 probably null Het
Serpina1e T C 12: 103,948,079 I329V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,034 unknown Het
Smc5 A G 19: 23,231,883 V639A probably benign Het
Speg T A 1: 75,423,268 V2453E probably damaging Het
Syt2 T A 1: 134,744,104 F207I probably damaging Het
Tchp C T 5: 114,708,796 S48L probably benign Het
Trim12a A G 7: 104,304,176 S243P possibly damaging Het
Ttn T C 2: 76,798,217 E14533G probably damaging Het
Vmn1r50 T A 6: 90,107,837 M188K probably benign Het
Vps11 G A 9: 44,355,079 T437I probably damaging Het
Xrn1 C T 9: 96,047,790 T1498I probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Zfp316 T C 5: 143,263,355 D175G unknown Het
Zmynd11 A G 13: 9,694,330 L256P probably damaging Het
Other mutations in Il18r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Il18r1 APN 1 40498652 missense possibly damaging 0.68
IGL00742:Il18r1 APN 1 40480991 missense probably benign 0.11
IGL01448:Il18r1 APN 1 40474730 missense probably damaging 1.00
IGL01726:Il18r1 APN 1 40498403 missense possibly damaging 0.83
IGL02081:Il18r1 APN 1 40498505 missense probably damaging 1.00
IGL02425:Il18r1 APN 1 40491221 splice site probably benign
IGL02447:Il18r1 APN 1 40498337 critical splice acceptor site probably null
IGL02529:Il18r1 APN 1 40487059 missense possibly damaging 0.77
IGL02863:Il18r1 APN 1 40487007 missense probably damaging 1.00
IGL02928:Il18r1 APN 1 40478551 critical splice donor site probably null
IGL02941:Il18r1 APN 1 40498551 missense probably damaging 0.99
IGL03156:Il18r1 APN 1 40498368 missense possibly damaging 0.92
R0532:Il18r1 UTSW 1 40474901 missense probably damaging 0.97
R0926:Il18r1 UTSW 1 40487028 missense probably damaging 1.00
R1909:Il18r1 UTSW 1 40474914 missense probably damaging 1.00
R2212:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R2254:Il18r1 UTSW 1 40491220 missense possibly damaging 0.91
R2860:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2861:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2862:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R3412:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R3432:Il18r1 UTSW 1 40487089 missense probably damaging 0.99
R3718:Il18r1 UTSW 1 40495788 missense probably benign 0.00
R3816:Il18r1 UTSW 1 40486972 splice site probably benign
R3894:Il18r1 UTSW 1 40474874 missense possibly damaging 0.79
R4061:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4062:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4381:Il18r1 UTSW 1 40471790 missense probably benign 0.00
R4972:Il18r1 UTSW 1 40491064 missense probably benign 0.39
R5059:Il18r1 UTSW 1 40481067 critical splice donor site probably null
R6229:Il18r1 UTSW 1 40474763 missense probably benign 0.02
R6458:Il18r1 UTSW 1 40491182 nonsense probably null
R6505:Il18r1 UTSW 1 40489707 missense probably benign
R6738:Il18r1 UTSW 1 40498656 missense probably benign 0.06
R7317:Il18r1 UTSW 1 40474832 missense possibly damaging 0.80
R7485:Il18r1 UTSW 1 40480980 missense probably benign 0.01
R7510:Il18r1 UTSW 1 40474875 missense probably benign 0.03
R7515:Il18r1 UTSW 1 40498670 missense not run
R7526:Il18r1 UTSW 1 40471772 missense probably damaging 0.99
R7793:Il18r1 UTSW 1 40471764 missense probably benign 0.01
R7870:Il18r1 UTSW 1 40491136 missense probably benign 0.45
R8004:Il18r1 UTSW 1 40474757 missense probably damaging 1.00
R8063:Il18r1 UTSW 1 40487038 missense probably benign 0.10
R8836:Il18r1 UTSW 1 40495856 missense probably benign 0.15
X0023:Il18r1 UTSW 1 40471761 missense probably benign 0.04
X0064:Il18r1 UTSW 1 40495713 splice site probably null
Z1088:Il18r1 UTSW 1 40474751 missense probably damaging 1.00
Z1088:Il18r1 UTSW 1 40478486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTCTTGCAATCTGCTGTAGAAAG -3'
(R):5'- TGTTTCCTGTTGAAGAGAGAACAG -3'

Sequencing Primer
(F):5'- CTGCTGTAGAAAGTTGTATTCACCG -3'
(R):5'- ATGCATGGATTATCATGAGCTTAC -3'
Posted On2019-05-13