Mutagenetix > Incidental Mutations

Incidental Mutation 'R7002:Irs1'

544571

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.567) question?

Stock #

R7002 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82288260 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 745 (Y745C)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

Predicted Effect

probably benign
Transcript: ENSMUST00000069799
AA Change: Y745C

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: Y745C

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,941,564	S1308P	probably damaging	Het
Abl2	A	T	1: 156,559,133	R29W	probably damaging	Het
Adam6b	C	A	12: 113,489,707	S48*	probably null	Het
Adamts18	T	A	8: 113,775,290	D313V	possibly damaging	Het
Aoc1	A	G	6: 48,905,876	S229G	probably benign	Het
Apol10a	G	A	15: 77,484,846	R15H	possibly damaging	Het
Bend4	T	A	5: 67,398,259	T535S	probably benign	Het
Blm	T	C	7: 80,469,753	K1024R	probably benign	Het
Brca2	T	C	5: 150,539,918	V1049A	probably benign	Het
Cerk	T	C	15: 86,156,594	Y188C	possibly damaging	Het
Cic	C	T	7: 25,272,196	R451C	probably damaging	Het
Col18a1	A	T	10: 77,166,343	V10E	unknown	Het
Cplx1	T	A	5: 108,520,316	K58M	probably damaging	Het
Crybg1	T	A	10: 43,998,835	D759V	probably damaging	Het
Cwc25	A	T	11: 97,748,071	N342K	probably damaging	Het
Dab2	A	T	15: 6,435,365	T566S	probably benign	Het
Depdc5	G	A	5: 32,877,158		probably null	Het
Dip2b	T	A	15: 100,160,465	N408K	probably benign	Het
Dnah12	T	C	14: 26,876,998	I3631T	probably damaging	Het
Dnase1	A	G	16: 4,039,546	I236V	possibly damaging	Het
Duox1	C	T	2: 122,319,877	Q196*	probably null	Het
Eef2k	G	A	7: 120,891,932	R547Q	probably benign	Het
Erich5	C	T	15: 34,471,362	L246F	probably damaging	Het
Frmpd1	C	T	4: 45,284,200	A1007V	probably benign	Het
Fsip2	T	A	2: 82,989,343	I5140N	possibly damaging	Het
Gan	T	C	8: 117,195,847	C440R	possibly damaging	Het
Garnl3	T	A	2: 33,054,193	H73L	possibly damaging	Het
Gid8	T	G	2: 180,713,303	M34R	possibly damaging	Het
Gjd4	C	A	18: 9,280,960	L39F	possibly damaging	Het
Gm5868	T	A	5: 72,586,420		probably null	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grhpr	T	C	4: 44,990,427	S306P	probably damaging	Het
Hdac4	T	G	1: 91,968,361	K729T	possibly damaging	Het
Hist2h2be	A	G	3: 96,221,373	I70V	probably benign	Het
Igfbp2	C	T	1: 72,849,645	H85Y	probably damaging	Het
Igkv4-61	T	G	6: 69,417,389	I13L	probably benign	Het
Il18r1	G	A	1: 40,474,853	S73N	probably benign	Het
Immt	T	C	6: 71,861,040	V244A	probably damaging	Het
Itpr3	T	C	17: 27,110,580	V1526A	probably benign	Het
Jrkl	A	T	9: 13,245,521	I45K	probably damaging	Het
Lamp3	G	T	16: 19,655,422	Q401K	possibly damaging	Het
Lrrfip1	T	A	1: 91,115,458	H528Q	probably benign	Het
Ltn1	A	T	16: 87,423,473	D245E	probably benign	Het
Mnat1	T	C	12: 73,230,705		probably benign	Het
Mpp6	C	T	6: 50,162,662	P116L	probably benign	Het
Mprip	A	C	11: 59,761,190	M1907L	probably benign	Het
Mut	T	A	17: 40,941,383	I272N	possibly damaging	Het
Nfu1	C	A	6: 87,016,272	H131Q	probably benign	Het
Nup188	T	A	2: 30,323,568	S670R	probably damaging	Het
Olfr1090	T	C	2: 86,754,681	D19G	probably benign	Het
Olfr1477	A	G	19: 13,502,675	N111D	probably benign	Het
Parp4	T	A	14: 56,602,404	V523E	probably damaging	Het
Pbrm1	T	A	14: 31,064,820	D631E	probably benign	Het
Prss40	A	T	1: 34,552,400		probably null	Het
Rnf13	A	G	3: 57,833,612	N274S	probably damaging	Het
Rtl1	T	A	12: 109,593,947	Y486F	probably damaging	Het
Sec14l3	A	T	11: 4,075,263	H291L	possibly damaging	Het
Senp5	A	G	16: 31,983,775	S532P	probably damaging	Het
Sepsecs	T	C	5: 52,647,208		probably null	Het
Serpina1e	T	C	12: 103,948,079	I329V	probably benign	Het
Slc35f3	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8: 126,389,034		unknown	Het
Smc5	A	G	19: 23,231,883	V639A	probably benign	Het
Speg	T	A	1: 75,423,268	V2453E	probably damaging	Het
Syt2	T	A	1: 134,744,104	F207I	probably damaging	Het
Tchp	C	T	5: 114,708,796	S48L	probably benign	Het
Trim12a	A	G	7: 104,304,176	S243P	possibly damaging	Het
Ttn	T	C	2: 76,798,217	E14533G	probably damaging	Het
Vmn1r50	T	A	6: 90,107,837	M188K	probably benign	Het
Vps11	G	A	9: 44,355,079	T437I	probably damaging	Het
Xrn1	C	T	9: 96,047,790	T1498I	probably benign	Het
Zfp236	A	G	18: 82,691,576		probably null	Het
Zfp316	T	C	5: 143,263,355	D175G	unknown	Het
Zmynd11	A	G	13: 9,694,330	L256P	probably damaging	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TTCGGCAGTTGCGGTATAGC -3'
(R):5'- GTAGTTGCTCCCCTGACATTGG -3'

Sequencing Primer
(F):5'- TGCGGTATAGCGAAGGCGTC -3'
(R):5'- TCCCCTGACATTGGAGGTG -3'

Posted On

2019-05-13