Mutagenetix > Incidental Mutations

Incidental Mutation 'R7002:Garnl3'

544576

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.292) question?

Stock #

R7002 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33054193 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 73 (H73L)

Ref Sequence

ENSEMBL: ENSMUSP00000099874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049618
AA Change: H77L

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: H77L

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	202	383	3.4e-73	PFAM
Pfam:CNH	475	780	3.5e-67	PFAM
low complexity region	793	804	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102810
AA Change: H73L

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: H73L

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	198	385	4.6e-67	PFAM
Pfam:CNH	471	776	1.8e-68	PFAM
low complexity region	789	800	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124000

SMART Domains

Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860

Domain	Start	End	E-Value	Type
low complexity region	6	24	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127509

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133135
AA Change: H118L

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137381
AA Change: H118L

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,941,564	S1308P	probably damaging	Het
Abl2	A	T	1: 156,559,133	R29W	probably damaging	Het
Adam6b	C	A	12: 113,489,707	S48*	probably null	Het
Adamts18	T	A	8: 113,775,290	D313V	possibly damaging	Het
Aoc1	A	G	6: 48,905,876	S229G	probably benign	Het
Apol10a	G	A	15: 77,484,846	R15H	possibly damaging	Het
Bend4	T	A	5: 67,398,259	T535S	probably benign	Het
Blm	T	C	7: 80,469,753	K1024R	probably benign	Het
Brca2	T	C	5: 150,539,918	V1049A	probably benign	Het
Cerk	T	C	15: 86,156,594	Y188C	possibly damaging	Het
Cic	C	T	7: 25,272,196	R451C	probably damaging	Het
Col18a1	A	T	10: 77,166,343	V10E	unknown	Het
Cplx1	T	A	5: 108,520,316	K58M	probably damaging	Het
Crybg1	T	A	10: 43,998,835	D759V	probably damaging	Het
Cwc25	A	T	11: 97,748,071	N342K	probably damaging	Het
Dab2	A	T	15: 6,435,365	T566S	probably benign	Het
Depdc5	G	A	5: 32,877,158		probably null	Het
Dip2b	T	A	15: 100,160,465	N408K	probably benign	Het
Dnah12	T	C	14: 26,876,998	I3631T	probably damaging	Het
Dnase1	A	G	16: 4,039,546	I236V	possibly damaging	Het
Duox1	C	T	2: 122,319,877	Q196*	probably null	Het
Eef2k	G	A	7: 120,891,932	R547Q	probably benign	Het
Erich5	C	T	15: 34,471,362	L246F	probably damaging	Het
Frmpd1	C	T	4: 45,284,200	A1007V	probably benign	Het
Fsip2	T	A	2: 82,989,343	I5140N	possibly damaging	Het
Gan	T	C	8: 117,195,847	C440R	possibly damaging	Het
Gid8	T	G	2: 180,713,303	M34R	possibly damaging	Het
Gjd4	C	A	18: 9,280,960	L39F	possibly damaging	Het
Gm5868	T	A	5: 72,586,420		probably null	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grhpr	T	C	4: 44,990,427	S306P	probably damaging	Het
Hdac4	T	G	1: 91,968,361	K729T	possibly damaging	Het
Hist2h2be	A	G	3: 96,221,373	I70V	probably benign	Het
Igfbp2	C	T	1: 72,849,645	H85Y	probably damaging	Het
Igkv4-61	T	G	6: 69,417,389	I13L	probably benign	Het
Il18r1	G	A	1: 40,474,853	S73N	probably benign	Het
Immt	T	C	6: 71,861,040	V244A	probably damaging	Het
Irs1	T	C	1: 82,288,260	Y745C	probably benign	Het
Itpr3	T	C	17: 27,110,580	V1526A	probably benign	Het
Jrkl	A	T	9: 13,245,521	I45K	probably damaging	Het
Lamp3	G	T	16: 19,655,422	Q401K	possibly damaging	Het
Lrrfip1	T	A	1: 91,115,458	H528Q	probably benign	Het
Ltn1	A	T	16: 87,423,473	D245E	probably benign	Het
Mnat1	T	C	12: 73,230,705		probably benign	Het
Mpp6	C	T	6: 50,162,662	P116L	probably benign	Het
Mprip	A	C	11: 59,761,190	M1907L	probably benign	Het
Mut	T	A	17: 40,941,383	I272N	possibly damaging	Het
Nfu1	C	A	6: 87,016,272	H131Q	probably benign	Het
Nup188	T	A	2: 30,323,568	S670R	probably damaging	Het
Olfr1090	T	C	2: 86,754,681	D19G	probably benign	Het
Olfr1477	A	G	19: 13,502,675	N111D	probably benign	Het
Parp4	T	A	14: 56,602,404	V523E	probably damaging	Het
Pbrm1	T	A	14: 31,064,820	D631E	probably benign	Het
Prss40	A	T	1: 34,552,400		probably null	Het
Rnf13	A	G	3: 57,833,612	N274S	probably damaging	Het
Rtl1	T	A	12: 109,593,947	Y486F	probably damaging	Het
Sec14l3	A	T	11: 4,075,263	H291L	possibly damaging	Het
Senp5	A	G	16: 31,983,775	S532P	probably damaging	Het
Sepsecs	T	C	5: 52,647,208		probably null	Het
Serpina1e	T	C	12: 103,948,079	I329V	probably benign	Het
Slc35f3	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8: 126,389,034		unknown	Het
Smc5	A	G	19: 23,231,883	V639A	probably benign	Het
Speg	T	A	1: 75,423,268	V2453E	probably damaging	Het
Syt2	T	A	1: 134,744,104	F207I	probably damaging	Het
Tchp	C	T	5: 114,708,796	S48L	probably benign	Het
Trim12a	A	G	7: 104,304,176	S243P	possibly damaging	Het
Ttn	T	C	2: 76,798,217	E14533G	probably damaging	Het
Vmn1r50	T	A	6: 90,107,837	M188K	probably benign	Het
Vps11	G	A	9: 44,355,079	T437I	probably damaging	Het
Xrn1	C	T	9: 96,047,790	T1498I	probably benign	Het
Zfp236	A	G	18: 82,691,576		probably null	Het
Zfp316	T	C	5: 143,263,355	D175G	unknown	Het
Zmynd11	A	G	13: 9,694,330	L256P	probably damaging	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0551:Garnl3	UTSW	2	33016738	missense	probably damaging	1.00
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0737:Garnl3	UTSW	2	32990642	missense	probably damaging	0.98
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1691:Garnl3	UTSW	2	32997663	nonsense	probably null
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R3847:Garnl3	UTSW	2	32992228	missense	probably benign
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6267:Garnl3	UTSW	2	33104880	missense	probably benign	0.20
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
R7746:Garnl3	UTSW	2	32992257	missense	probably damaging	1.00
R7919:Garnl3	UTSW	2	33046599	missense	probably benign	0.38
R8079:Garnl3	UTSW	2	33018499	critical splice donor site	probably null
R8087:Garnl3	UTSW	2	33045536	missense	probably benign	0.01
R8123:Garnl3	UTSW	2	33104938	missense	probably damaging	0.97
R8170:Garnl3	UTSW	2	33015223	missense	possibly damaging	0.88
R8347:Garnl3	UTSW	2	33085891	missense	probably damaging	1.00
R8418:Garnl3	UTSW	2	33052146	missense	possibly damaging	0.73
R8679:Garnl3	UTSW	2	33026094	missense	probably damaging	1.00
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTTGAAGCTTTTAGCCCACG -3'
(R):5'- ATGTGGTGACAGCCCTTATTCG -3'

Sequencing Primer
(F):5'- GCTTTTAGCCCACGAAGCC -3'
(R):5'- GTGACAGCCCTTATTCGTGTGC -3'

Posted On

2019-05-13