Incidental Mutation 'R7002:Abca8b'
ID544614
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7002 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109941564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1308 (S1308P)
Ref Sequence ENSEMBL: ENSMUSP00000020948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably damaging
Transcript: ENSMUST00000020948
AA Change: S1308P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: S1308P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106669
AA Change: S1246P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: S1246P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,559,133 R29W probably damaging Het
Adam6b C A 12: 113,489,707 S48* probably null Het
Adamts18 T A 8: 113,775,290 D313V possibly damaging Het
Aoc1 A G 6: 48,905,876 S229G probably benign Het
Apol10a G A 15: 77,484,846 R15H possibly damaging Het
Bend4 T A 5: 67,398,259 T535S probably benign Het
Blm T C 7: 80,469,753 K1024R probably benign Het
Brca2 T C 5: 150,539,918 V1049A probably benign Het
Cerk T C 15: 86,156,594 Y188C possibly damaging Het
Cic C T 7: 25,272,196 R451C probably damaging Het
Col18a1 A T 10: 77,166,343 V10E unknown Het
Cplx1 T A 5: 108,520,316 K58M probably damaging Het
Crybg1 T A 10: 43,998,835 D759V probably damaging Het
Cwc25 A T 11: 97,748,071 N342K probably damaging Het
Dab2 A T 15: 6,435,365 T566S probably benign Het
Depdc5 G A 5: 32,877,158 probably null Het
Dip2b T A 15: 100,160,465 N408K probably benign Het
Dnah12 T C 14: 26,876,998 I3631T probably damaging Het
Dnase1 A G 16: 4,039,546 I236V possibly damaging Het
Duox1 C T 2: 122,319,877 Q196* probably null Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Erich5 C T 15: 34,471,362 L246F probably damaging Het
Frmpd1 C T 4: 45,284,200 A1007V probably benign Het
Fsip2 T A 2: 82,989,343 I5140N possibly damaging Het
Gan T C 8: 117,195,847 C440R possibly damaging Het
Garnl3 T A 2: 33,054,193 H73L possibly damaging Het
Gid8 T G 2: 180,713,303 M34R possibly damaging Het
Gjd4 C A 18: 9,280,960 L39F possibly damaging Het
Gm5868 T A 5: 72,586,420 probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grhpr T C 4: 44,990,427 S306P probably damaging Het
Hdac4 T G 1: 91,968,361 K729T possibly damaging Het
Hist2h2be A G 3: 96,221,373 I70V probably benign Het
Igfbp2 C T 1: 72,849,645 H85Y probably damaging Het
Igkv4-61 T G 6: 69,417,389 I13L probably benign Het
Il18r1 G A 1: 40,474,853 S73N probably benign Het
Immt T C 6: 71,861,040 V244A probably damaging Het
Irs1 T C 1: 82,288,260 Y745C probably benign Het
Itpr3 T C 17: 27,110,580 V1526A probably benign Het
Jrkl A T 9: 13,245,521 I45K probably damaging Het
Lamp3 G T 16: 19,655,422 Q401K possibly damaging Het
Lrrfip1 T A 1: 91,115,458 H528Q probably benign Het
Ltn1 A T 16: 87,423,473 D245E probably benign Het
Mnat1 T C 12: 73,230,705 probably benign Het
Mpp6 C T 6: 50,162,662 P116L probably benign Het
Mprip A C 11: 59,761,190 M1907L probably benign Het
Mut T A 17: 40,941,383 I272N possibly damaging Het
Nfu1 C A 6: 87,016,272 H131Q probably benign Het
Nup188 T A 2: 30,323,568 S670R probably damaging Het
Olfr1090 T C 2: 86,754,681 D19G probably benign Het
Olfr1477 A G 19: 13,502,675 N111D probably benign Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pbrm1 T A 14: 31,064,820 D631E probably benign Het
Prss40 A T 1: 34,552,400 probably null Het
Rnf13 A G 3: 57,833,612 N274S probably damaging Het
Rtl1 T A 12: 109,593,947 Y486F probably damaging Het
Sec14l3 A T 11: 4,075,263 H291L possibly damaging Het
Senp5 A G 16: 31,983,775 S532P probably damaging Het
Sepsecs T C 5: 52,647,208 probably null Het
Serpina1e T C 12: 103,948,079 I329V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,034 unknown Het
Smc5 A G 19: 23,231,883 V639A probably benign Het
Speg T A 1: 75,423,268 V2453E probably damaging Het
Syt2 T A 1: 134,744,104 F207I probably damaging Het
Tchp C T 5: 114,708,796 S48L probably benign Het
Trim12a A G 7: 104,304,176 S243P possibly damaging Het
Ttn T C 2: 76,798,217 E14533G probably damaging Het
Vmn1r50 T A 6: 90,107,837 M188K probably benign Het
Vps11 G A 9: 44,355,079 T437I probably damaging Het
Xrn1 C T 9: 96,047,790 T1498I probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Zfp316 T C 5: 143,263,355 D175G unknown Het
Zmynd11 A G 13: 9,694,330 L256P probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R8074:Abca8b UTSW 11 109938494 missense probably benign
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATAGAGCTGGGCCCCTATTC -3'
(R):5'- TCTCTTTGATGCACAGTTAGGG -3'

Sequencing Primer
(F):5'- GCCCCTATTCTTGGAGTGAATG -3'
(R):5'- CACAGTTAGGGTAGTGTAGGGATTAC -3'
Posted On2019-05-13