Incidental Mutation 'R7002:Smc5'
ID544638
Institutional Source Beutler Lab
Gene Symbol Smc5
Ensembl Gene ENSMUSG00000024943
Gene Namestructural maintenance of chromosomes 5
SynonymsSmc5l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7002 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location23206451-23273897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23231883 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 639 (V639A)
Ref Sequence ENSEMBL: ENSMUSP00000153364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087556] [ENSMUST00000223934] [ENSMUST00000226111]
Predicted Effect probably benign
Transcript: ENSMUST00000087556
AA Change: V639A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943
AA Change: V639A

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223934
AA Change: V639A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226111
AA Change: V563A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Homozygous knockout in embryonic stem cells causes abnormal mitosis, increased apoptosis and a shift from pluripotency to differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,941,564 S1308P probably damaging Het
Abl2 A T 1: 156,559,133 R29W probably damaging Het
Adam6b C A 12: 113,489,707 S48* probably null Het
Adamts18 T A 8: 113,775,290 D313V possibly damaging Het
Aoc1 A G 6: 48,905,876 S229G probably benign Het
Apol10a G A 15: 77,484,846 R15H possibly damaging Het
Bend4 T A 5: 67,398,259 T535S probably benign Het
Blm T C 7: 80,469,753 K1024R probably benign Het
Brca2 T C 5: 150,539,918 V1049A probably benign Het
Cerk T C 15: 86,156,594 Y188C possibly damaging Het
Cic C T 7: 25,272,196 R451C probably damaging Het
Col18a1 A T 10: 77,166,343 V10E unknown Het
Cplx1 T A 5: 108,520,316 K58M probably damaging Het
Crybg1 T A 10: 43,998,835 D759V probably damaging Het
Cwc25 A T 11: 97,748,071 N342K probably damaging Het
Dab2 A T 15: 6,435,365 T566S probably benign Het
Depdc5 G A 5: 32,877,158 probably null Het
Dip2b T A 15: 100,160,465 N408K probably benign Het
Dnah12 T C 14: 26,876,998 I3631T probably damaging Het
Dnase1 A G 16: 4,039,546 I236V possibly damaging Het
Duox1 C T 2: 122,319,877 Q196* probably null Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Erich5 C T 15: 34,471,362 L246F probably damaging Het
Frmpd1 C T 4: 45,284,200 A1007V probably benign Het
Fsip2 T A 2: 82,989,343 I5140N possibly damaging Het
Gan T C 8: 117,195,847 C440R possibly damaging Het
Garnl3 T A 2: 33,054,193 H73L possibly damaging Het
Gid8 T G 2: 180,713,303 M34R possibly damaging Het
Gjd4 C A 18: 9,280,960 L39F possibly damaging Het
Gm5868 T A 5: 72,586,420 probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grhpr T C 4: 44,990,427 S306P probably damaging Het
Hdac4 T G 1: 91,968,361 K729T possibly damaging Het
Hist2h2be A G 3: 96,221,373 I70V probably benign Het
Igfbp2 C T 1: 72,849,645 H85Y probably damaging Het
Igkv4-61 T G 6: 69,417,389 I13L probably benign Het
Il18r1 G A 1: 40,474,853 S73N probably benign Het
Immt T C 6: 71,861,040 V244A probably damaging Het
Irs1 T C 1: 82,288,260 Y745C probably benign Het
Itpr3 T C 17: 27,110,580 V1526A probably benign Het
Jrkl A T 9: 13,245,521 I45K probably damaging Het
Lamp3 G T 16: 19,655,422 Q401K possibly damaging Het
Lrrfip1 T A 1: 91,115,458 H528Q probably benign Het
Ltn1 A T 16: 87,423,473 D245E probably benign Het
Mnat1 T C 12: 73,230,705 probably benign Het
Mpp6 C T 6: 50,162,662 P116L probably benign Het
Mprip A C 11: 59,761,190 M1907L probably benign Het
Mut T A 17: 40,941,383 I272N possibly damaging Het
Nfu1 C A 6: 87,016,272 H131Q probably benign Het
Nup188 T A 2: 30,323,568 S670R probably damaging Het
Olfr1090 T C 2: 86,754,681 D19G probably benign Het
Olfr1477 A G 19: 13,502,675 N111D probably benign Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pbrm1 T A 14: 31,064,820 D631E probably benign Het
Prss40 A T 1: 34,552,400 probably null Het
Rnf13 A G 3: 57,833,612 N274S probably damaging Het
Rtl1 T A 12: 109,593,947 Y486F probably damaging Het
Sec14l3 A T 11: 4,075,263 H291L possibly damaging Het
Senp5 A G 16: 31,983,775 S532P probably damaging Het
Sepsecs T C 5: 52,647,208 probably null Het
Serpina1e T C 12: 103,948,079 I329V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,034 unknown Het
Speg T A 1: 75,423,268 V2453E probably damaging Het
Syt2 T A 1: 134,744,104 F207I probably damaging Het
Tchp C T 5: 114,708,796 S48L probably benign Het
Trim12a A G 7: 104,304,176 S243P possibly damaging Het
Ttn T C 2: 76,798,217 E14533G probably damaging Het
Vmn1r50 T A 6: 90,107,837 M188K probably benign Het
Vps11 G A 9: 44,355,079 T437I probably damaging Het
Xrn1 C T 9: 96,047,790 T1498I probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Zfp316 T C 5: 143,263,355 D175G unknown Het
Zmynd11 A G 13: 9,694,330 L256P probably damaging Het
Other mutations in Smc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Smc5 APN 19 23235965 missense probably damaging 1.00
IGL01070:Smc5 APN 19 23231601 missense possibly damaging 0.86
IGL01315:Smc5 APN 19 23231604 missense probably benign
IGL01879:Smc5 APN 19 23228184 missense probably damaging 0.97
IGL01902:Smc5 APN 19 23259768 missense possibly damaging 0.85
IGL02016:Smc5 APN 19 23273712 missense probably benign 0.00
IGL02186:Smc5 APN 19 23231859 missense probably damaging 1.00
IGL02383:Smc5 APN 19 23214632 splice site probably benign
IGL02447:Smc5 APN 19 23257492 missense probably benign 0.01
IGL02534:Smc5 APN 19 23228172 critical splice donor site probably null
IGL02834:Smc5 APN 19 23257604 missense probably benign 0.30
IGL03290:Smc5 APN 19 23273658 missense probably benign 0.19
R0722:Smc5 UTSW 19 23208927 missense probably damaging 0.99
R0893:Smc5 UTSW 19 23263653 missense possibly damaging 0.67
R0970:Smc5 UTSW 19 23238998 missense probably damaging 1.00
R1281:Smc5 UTSW 19 23235883 missense probably benign
R1368:Smc5 UTSW 19 23210443 missense probably damaging 1.00
R2092:Smc5 UTSW 19 23238899 missense probably benign
R3721:Smc5 UTSW 19 23210492 missense probably benign 0.21
R4382:Smc5 UTSW 19 23268846 missense probably benign 0.39
R4735:Smc5 UTSW 19 23242705 missense probably benign
R4936:Smc5 UTSW 19 23234003 missense probably damaging 1.00
R5306:Smc5 UTSW 19 23259645 critical splice donor site probably null
R5754:Smc5 UTSW 19 23244103 missense possibly damaging 0.92
R6175:Smc5 UTSW 19 23214170 missense possibly damaging 0.60
R6313:Smc5 UTSW 19 23208948 nonsense probably null
R6527:Smc5 UTSW 19 23228190 missense probably benign 0.00
R6611:Smc5 UTSW 19 23228919 missense probably benign 0.13
R6750:Smc5 UTSW 19 23242640 missense probably damaging 1.00
R6801:Smc5 UTSW 19 23214646 missense probably benign 0.34
R6821:Smc5 UTSW 19 23242787 missense probably benign 0.20
R7198:Smc5 UTSW 19 23259700 nonsense probably null
R7386:Smc5 UTSW 19 23215175 missense possibly damaging 0.59
R7439:Smc5 UTSW 19 23242700 missense probably damaging 0.97
R7596:Smc5 UTSW 19 23214169 missense probably damaging 0.99
R7666:Smc5 UTSW 19 23229017 missense probably benign 0.15
R7760:Smc5 UTSW 19 23235890 missense probably benign 0.01
R7990:Smc5 UTSW 19 23235882 missense probably benign 0.01
R8255:Smc5 UTSW 19 23208926 missense
R8359:Smc5 UTSW 19 23234079 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AACCCTGAGTCCACTGCTTC -3'
(R):5'- TGCTCTACTAGAATTCGCCTGG -3'

Sequencing Primer
(F):5'- CCAGTTGTCTATTCATTTCCTAAGG -3'
(R):5'- CTCTACTAGAATTCGCCTGGGTTTTG -3'
Posted On2019-05-13