Incidental Mutation 'R7003:Armc3'
ID544641
Institutional Source Beutler Lab
Gene Symbol Armc3
Ensembl Gene ENSMUSG00000037683
Gene Namearmadillo repeat containing 3
Synonyms4921513G22Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7003 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location19199302-19310241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19270028 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 358 (I358T)
Ref Sequence ENSEMBL: ENSMUSP00000110287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]
Predicted Effect probably damaging
Transcript: ENSMUST00000049255
AA Change: I358T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: I358T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
low complexity region 544 557 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 675 696 N/A INTRINSIC
Pfam:EDR1 723 857 3.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114640
AA Change: I358T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: I358T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
Pfam:EDR1 549 868 1.4e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,228,762 L2164R probably damaging Het
Actbl2 T A 13: 111,255,956 I275N probably damaging Het
Actr3b A C 5: 25,798,463 Y21S probably damaging Het
Adam6b C T 12: 113,490,042 Q160* probably null Het
Adgrv1 C T 13: 81,522,104 probably null Het
Akr1c6 A G 13: 4,454,515 N300D probably benign Het
Alox8 T C 11: 69,191,590 D170G possibly damaging Het
Amhr2 A G 15: 102,446,333 N40S probably benign Het
Ap2a2 A G 7: 141,629,196 N767S probably benign Het
Atg2b A G 12: 105,654,249 S732P probably benign Het
Atp12a A G 14: 56,373,380 Y327C possibly damaging Het
Bcr T C 10: 75,061,561 V179A probably benign Het
Cep104 T C 4: 153,993,561 L642P probably benign Het
Clspn T A 4: 126,592,720 S1302R possibly damaging Het
Cmip T C 8: 117,384,988 F153L probably benign Het
D630039A03Rik T C 4: 57,910,521 D97G probably damaging Het
Dok7 A T 5: 35,079,555 T396S probably benign Het
Dsel C T 1: 111,860,295 V837I probably benign Het
Etl4 C T 2: 20,805,884 T926I probably benign Het
Gm7102 A G 19: 61,175,881 S39P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gpr155 A G 2: 73,343,617 I816T probably damaging Het
Hpn C T 7: 31,110,942 probably benign Het
Inpp5e A G 2: 26,397,865 S640P probably benign Het
Irs3 C T 5: 137,645,277 V82I probably benign Het
Kif16b A C 2: 142,758,829 D461E possibly damaging Het
Krba1 A G 6: 48,413,080 T592A possibly damaging Het
Lgsn T A 1: 31,203,943 S369T possibly damaging Het
Lrrc4b C T 7: 44,445,156 P83S probably damaging Het
Neil3 T C 8: 53,600,966 T343A possibly damaging Het
Nt5e A G 9: 88,364,752 Y347C probably damaging Het
Olfr1532-ps1 A T 7: 106,915,112 T305S probably benign Het
Olfr3 A G 2: 36,813,035 I19T possibly damaging Het
Olfr452 C T 6: 42,790,465 T142I probably benign Het
Olfr943 A T 9: 39,184,943 Y255F probably benign Het
P2rx5 T C 11: 73,167,974 probably null Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Plekhd1 T C 12: 80,721,960 C406R possibly damaging Het
Plod3 T A 5: 136,989,644 N245K probably damaging Het
Polr3c G T 3: 96,723,638 H155Q possibly damaging Het
Psap T A 10: 60,299,497 C317S probably damaging Het
Rif1 A G 2: 52,076,989 I97V probably benign Het
Rnf123 T A 9: 108,063,683 probably null Het
Rnf19a G A 15: 36,254,504 R303* probably null Het
Sdk1 G A 5: 142,096,734 V1036I probably benign Het
Shc3 T A 13: 51,466,552 Y146F probably benign Het
Skint6 A G 4: 113,105,912 Y441H probably benign Het
Slc7a12 T C 3: 14,505,520 I173T probably damaging Het
Spesp1 A T 9: 62,282,020 S15T possibly damaging Het
Tarm1 A T 7: 3,497,423 probably null Het
Tenm3 T C 8: 48,240,444 Y1817C probably damaging Het
Ttc9c A T 19: 8,818,540 L45Q probably damaging Het
Ube3a C T 7: 59,276,440 T322I probably damaging Het
Vac14 T A 8: 110,712,798 V669E probably damaging Het
Vmn1r225 A G 17: 20,503,154 M286V probably null Het
Zfp658 A G 7: 43,574,748 K816E possibly damaging Het
Zfp846 T C 9: 20,587,892 M1T probably null Het
Other mutations in Armc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Armc3 APN 2 19303858 missense possibly damaging 0.48
IGL01123:Armc3 APN 2 19201805 missense possibly damaging 0.87
IGL01142:Armc3 APN 2 19297898 splice site probably benign
IGL01556:Armc3 APN 2 19269146 missense probably damaging 1.00
IGL02145:Armc3 APN 2 19296860 missense possibly damaging 0.81
IGL02145:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02152:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02154:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02243:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02244:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02516:Armc3 APN 2 19300506 missense possibly damaging 0.94
IGL02691:Armc3 APN 2 19235484 missense probably damaging 1.00
IGL03151:Armc3 APN 2 19238698 missense probably damaging 1.00
IGL03190:Armc3 APN 2 19288950 missense probably damaging 0.99
IGL03288:Armc3 APN 2 19235482 missense probably damaging 1.00
IGL03338:Armc3 APN 2 19248701 missense possibly damaging 0.88
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0256:Armc3 UTSW 2 19269216 missense probably damaging 1.00
R0621:Armc3 UTSW 2 19295393 missense probably damaging 0.96
R1326:Armc3 UTSW 2 19310124 makesense probably null
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1489:Armc3 UTSW 2 19310047 missense probably benign 0.01
R1990:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1991:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1992:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R2002:Armc3 UTSW 2 19288936 missense probably benign 0.01
R2095:Armc3 UTSW 2 19288929 missense possibly damaging 0.65
R2127:Armc3 UTSW 2 19201811 missense probably damaging 1.00
R2158:Armc3 UTSW 2 19248633 missense probably damaging 0.99
R2697:Armc3 UTSW 2 19303935 missense probably damaging 1.00
R3809:Armc3 UTSW 2 19300665 missense probably damaging 1.00
R3897:Armc3 UTSW 2 19269177 missense probably damaging 1.00
R4107:Armc3 UTSW 2 19288909 missense probably benign 0.13
R4326:Armc3 UTSW 2 19300473 missense probably damaging 0.97
R4464:Armc3 UTSW 2 19248659 missense probably damaging 0.99
R4702:Armc3 UTSW 2 19309981 missense probably damaging 1.00
R4923:Armc3 UTSW 2 19292980 critical splice acceptor site probably null
R5370:Armc3 UTSW 2 19286062 missense probably benign 0.00
R5518:Armc3 UTSW 2 19297928 missense probably benign 0.28
R5718:Armc3 UTSW 2 19303799 nonsense probably null
R5739:Armc3 UTSW 2 19253917 missense possibly damaging 0.67
R5913:Armc3 UTSW 2 19310047 missense possibly damaging 0.65
R6211:Armc3 UTSW 2 19296803 critical splice acceptor site probably null
R6245:Armc3 UTSW 2 19248705 missense probably damaging 1.00
R6841:Armc3 UTSW 2 19201819 splice site probably null
R7190:Armc3 UTSW 2 19293136 missense probably damaging 1.00
R7499:Armc3 UTSW 2 19285979 missense probably benign 0.03
R7738:Armc3 UTSW 2 19288950 missense probably damaging 0.99
R7844:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R7927:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R8060:Armc3 UTSW 2 19288909 missense probably benign 0.08
Z1177:Armc3 UTSW 2 19285991 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTGACCATGCTCAGACTG -3'
(R):5'- ACTACTTTCATAAGGGACCCCAAAG -3'

Sequencing Primer
(F):5'- ACCATGCTCAGACTGTGTAGTGAC -3'
(R):5'- AAGTCAGATTACCTAAGAAAACATGG -3'
Posted On2019-05-13