Incidental Mutation 'R7003:Olfr3'
ID544644
Institutional Source Beutler Lab
Gene Symbol Olfr3
Ensembl Gene ENSMUSG00000075384
Gene Nameolfactory receptor 3
SynonymsMOR136-14, Y71, GA_x6K02T2NLDC-33507606-33506665
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7003 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36811492-36817032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36813035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 19 (I19T)
Ref Sequence ENSEMBL: ENSMUSP00000149118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100151] [ENSMUST00000213988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100151
AA Change: I19T

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097728
Gene: ENSMUSG00000075384
AA Change: I19T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 220 2.9e-7 PFAM
Pfam:7tm_1 41 290 6.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213988
AA Change: I19T

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,228,762 L2164R probably damaging Het
Actbl2 T A 13: 111,255,956 I275N probably damaging Het
Actr3b A C 5: 25,798,463 Y21S probably damaging Het
Adam6b C T 12: 113,490,042 Q160* probably null Het
Adgrv1 C T 13: 81,522,104 probably null Het
Akr1c6 A G 13: 4,454,515 N300D probably benign Het
Alox8 T C 11: 69,191,590 D170G possibly damaging Het
Amhr2 A G 15: 102,446,333 N40S probably benign Het
Ap2a2 A G 7: 141,629,196 N767S probably benign Het
Armc3 T C 2: 19,270,028 I358T probably damaging Het
Atg2b A G 12: 105,654,249 S732P probably benign Het
Atp12a A G 14: 56,373,380 Y327C possibly damaging Het
Bcr T C 10: 75,061,561 V179A probably benign Het
Cep104 T C 4: 153,993,561 L642P probably benign Het
Clspn T A 4: 126,592,720 S1302R possibly damaging Het
Cmip T C 8: 117,384,988 F153L probably benign Het
D630039A03Rik T C 4: 57,910,521 D97G probably damaging Het
Dok7 A T 5: 35,079,555 T396S probably benign Het
Dsel C T 1: 111,860,295 V837I probably benign Het
Etl4 C T 2: 20,805,884 T926I probably benign Het
Gm7102 A G 19: 61,175,881 S39P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gpr155 A G 2: 73,343,617 I816T probably damaging Het
Hpn C T 7: 31,110,942 probably benign Het
Inpp5e A G 2: 26,397,865 S640P probably benign Het
Irs3 C T 5: 137,645,277 V82I probably benign Het
Kif16b A C 2: 142,758,829 D461E possibly damaging Het
Krba1 A G 6: 48,413,080 T592A possibly damaging Het
Lgsn T A 1: 31,203,943 S369T possibly damaging Het
Lrrc4b C T 7: 44,445,156 P83S probably damaging Het
Neil3 T C 8: 53,600,966 T343A possibly damaging Het
Nt5e A G 9: 88,364,752 Y347C probably damaging Het
Olfr1532-ps1 A T 7: 106,915,112 T305S probably benign Het
Olfr452 C T 6: 42,790,465 T142I probably benign Het
Olfr943 A T 9: 39,184,943 Y255F probably benign Het
P2rx5 T C 11: 73,167,974 probably null Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Plekhd1 T C 12: 80,721,960 C406R possibly damaging Het
Plod3 T A 5: 136,989,644 N245K probably damaging Het
Polr3c G T 3: 96,723,638 H155Q possibly damaging Het
Psap T A 10: 60,299,497 C317S probably damaging Het
Rif1 A G 2: 52,076,989 I97V probably benign Het
Rnf123 T A 9: 108,063,683 probably null Het
Rnf19a G A 15: 36,254,504 R303* probably null Het
Sdk1 G A 5: 142,096,734 V1036I probably benign Het
Shc3 T A 13: 51,466,552 Y146F probably benign Het
Skint6 A G 4: 113,105,912 Y441H probably benign Het
Slc7a12 T C 3: 14,505,520 I173T probably damaging Het
Spesp1 A T 9: 62,282,020 S15T possibly damaging Het
Tarm1 A T 7: 3,497,423 probably null Het
Tenm3 T C 8: 48,240,444 Y1817C probably damaging Het
Ttc9c A T 19: 8,818,540 L45Q probably damaging Het
Ube3a C T 7: 59,276,440 T322I probably damaging Het
Vac14 T A 8: 110,712,798 V669E probably damaging Het
Vmn1r225 A G 17: 20,503,154 M286V probably null Het
Zfp658 A G 7: 43,574,748 K816E possibly damaging Het
Zfp846 T C 9: 20,587,892 M1T probably null Het
Other mutations in Olfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Olfr3 APN 2 36812403 missense probably benign
R0501:Olfr3 UTSW 2 36812480 nonsense probably null
R0519:Olfr3 UTSW 2 36812615 missense probably damaging 1.00
R0890:Olfr3 UTSW 2 36812574 missense probably benign 0.06
R1353:Olfr3 UTSW 2 36812914 missense possibly damaging 0.59
R1543:Olfr3 UTSW 2 36813057 missense probably damaging 1.00
R3435:Olfr3 UTSW 2 36812678 missense probably benign 0.06
R4378:Olfr3 UTSW 2 36812469 missense probably benign
R4585:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4586:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4626:Olfr3 UTSW 2 36812259 missense probably damaging 0.98
R4714:Olfr3 UTSW 2 36813035 missense probably benign 0.37
R4720:Olfr3 UTSW 2 36812472 missense probably benign 0.03
R5390:Olfr3 UTSW 2 36812432 missense probably benign
R5659:Olfr3 UTSW 2 36812954 missense probably damaging 1.00
R5681:Olfr3 UTSW 2 36812681 missense probably benign 0.18
R6750:Olfr3 UTSW 2 36812942 missense possibly damaging 0.90
R7353:Olfr3 UTSW 2 36812903 missense probably damaging 1.00
R7514:Olfr3 UTSW 2 36812639 missense probably benign 0.03
R8094:Olfr3 UTSW 2 36812318 missense probably damaging 1.00
R8298:Olfr3 UTSW 2 36813026 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCTTCGGGACAGTGACAGATG -3'
(R):5'- TTACAGAGACTGGGATCAGACTG -3'

Sequencing Primer
(F):5'- TCTTCGGGACAGTGACAGATGAAAAG -3'
(R):5'- TTCTCCACAATATTTGCAGCAAAAC -3'
Posted On2019-05-13