Mutagenetix > Incidental Mutation

Incidental Mutation 'R7003:Clspn'

544652

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7003 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 126592720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1302 (S1302R)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

AlphaFold

Q80YR7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048391
AA Change: S1302R

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: S1302R

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	G	15: 8,228,762	L2164R	probably damaging	Het
Actbl2	T	A	13: 111,255,956	I275N	probably damaging	Het
Actr3b	A	C	5: 25,798,463	Y21S	probably damaging	Het
Adam6b	C	T	12: 113,490,042	Q160*	probably null	Het
Adgrv1	C	T	13: 81,522,104		probably null	Het
Akr1c6	A	G	13: 4,454,515	N300D	probably benign	Het
Alox8	T	C	11: 69,191,590	D170G	possibly damaging	Het
Amhr2	A	G	15: 102,446,333	N40S	probably benign	Het
Ap2a2	A	G	7: 141,629,196	N767S	probably benign	Het
Armc3	T	C	2: 19,270,028	I358T	probably damaging	Het
Atg2b	A	G	12: 105,654,249	S732P	probably benign	Het
Atp12a	A	G	14: 56,373,380	Y327C	possibly damaging	Het
Bcr	T	C	10: 75,061,561	V179A	probably benign	Het
Cep104	T	C	4: 153,993,561	L642P	probably benign	Het
Cmip	T	C	8: 117,384,988	F153L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,521	D97G	probably damaging	Het
Dok7	A	T	5: 35,079,555	T396S	probably benign	Het
Dsel	C	T	1: 111,860,295	V837I	probably benign	Het
Etl4	C	T	2: 20,805,884	T926I	probably benign	Het
Gm7102	A	G	19: 61,175,881	S39P	possibly damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gpr155	A	G	2: 73,343,617	I816T	probably damaging	Het
Hpn	C	T	7: 31,110,942		probably benign	Het
Inpp5e	A	G	2: 26,397,865	S640P	probably benign	Het
Irs3	C	T	5: 137,645,277	V82I	probably benign	Het
Kif16b	A	C	2: 142,758,829	D461E	possibly damaging	Het
Krba1	A	G	6: 48,413,080	T592A	possibly damaging	Het
Lgsn	T	A	1: 31,203,943	S369T	possibly damaging	Het
Lrrc4b	C	T	7: 44,445,156	P83S	probably damaging	Het
Neil3	T	C	8: 53,600,966	T343A	possibly damaging	Het
Nt5e	A	G	9: 88,364,752	Y347C	probably damaging	Het
Olfr1532-ps1	A	T	7: 106,915,112	T305S	probably benign	Het
Olfr3	A	G	2: 36,813,035	I19T	possibly damaging	Het
Olfr452	C	T	6: 42,790,465	T142I	probably benign	Het
Olfr943	A	T	9: 39,184,943	Y255F	probably benign	Het
P2rx5	T	C	11: 73,167,974		probably null	Het
Phtf2	A	G	5: 20,794,401	V248A	probably benign	Het
Plekhd1	T	C	12: 80,721,960	C406R	possibly damaging	Het
Plod3	T	A	5: 136,989,644	N245K	probably damaging	Het
Polr3c	G	T	3: 96,723,638	H155Q	possibly damaging	Het
Psap	T	A	10: 60,299,497	C317S	probably damaging	Het
Rif1	A	G	2: 52,076,989	I97V	probably benign	Het
Rnf123	T	A	9: 108,063,683		probably null	Het
Rnf19a	G	A	15: 36,254,504	R303*	probably null	Het
Sdk1	G	A	5: 142,096,734	V1036I	probably benign	Het
Shc3	T	A	13: 51,466,552	Y146F	probably benign	Het
Skint6	A	G	4: 113,105,912	Y441H	probably benign	Het
Slc7a12	T	C	3: 14,505,520	I173T	probably damaging	Het
Spesp1	A	T	9: 62,282,020	S15T	possibly damaging	Het
Tarm1	A	T	7: 3,497,423		probably null	Het
Tenm3	T	C	8: 48,240,444	Y1817C	probably damaging	Het
Ttc9c	A	T	19: 8,818,540	L45Q	probably damaging	Het
Ube3a	C	T	7: 59,276,440	T322I	probably damaging	Het
Vac14	T	A	8: 110,712,798	V669E	probably damaging	Het
Vmn1r225	A	G	17: 20,503,154	M286V	probably null	Het
Zfp658	A	G	7: 43,574,748	K816E	possibly damaging	Het
Zfp846	T	C	9: 20,587,892	M1T	probably null	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAATTTATAGCGGAGTTGCTGC -3'
(R):5'- GAAGGGAAGCTCGGCTCATTAC -3'

Sequencing Primer
(F):5'- GAGTTGCTGCTCCAATGGACAATC -3'
(R):5'- CGGCTCATTACGAGTTGATTC -3'

Posted On

2019-05-13