Incidental Mutation 'R0609:Cps1'
ID54467
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission 038798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0609 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67172802 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 710 (Y710D)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably damaging
Transcript: ENSMUST00000027144
AA Change: Y710D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: Y710D

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A T 14: 35,811,461 probably null Het
Abcb4 T A 5: 8,947,376 C952S probably damaging Het
Adamtsl2 A G 2: 27,089,635 D272G probably benign Het
Aim2 G A 1: 173,461,964 D158N probably damaging Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Apoc2 A G 7: 19,673,353 S28P probably benign Het
Arfgef3 G A 10: 18,597,431 T1628I probably benign Het
Atp10a G A 7: 58,819,740 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
Brsk2 T C 7: 141,998,492 Y618H probably damaging Het
Casp12 T A 9: 5,346,554 F27Y probably damaging Het
Casp8 T A 1: 58,844,792 N439K probably benign Het
Ccdc175 T A 12: 72,157,507 K253N probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cdk17 T C 10: 93,216,472 M105T probably benign Het
Cdon C A 9: 35,478,611 P854T probably damaging Het
Cep44 A G 8: 56,544,152 M117T possibly damaging Het
Cep89 A T 7: 35,435,530 E674D probably damaging Het
Cit C T 5: 115,873,943 A203V probably damaging Het
Clstn1 C A 4: 149,629,300 probably null Het
Col7a1 T A 9: 108,958,147 D565E unknown Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dars A G 1: 128,405,381 V102A probably benign Het
Dhx35 C T 2: 158,817,415 T168I possibly damaging Het
Dnah5 T C 15: 28,327,779 S2100P probably benign Het
Dst T C 1: 34,266,960 probably null Het
Egflam A C 15: 7,253,523 L351R possibly damaging Het
Elp2 T A 18: 24,626,156 D523E probably benign Het
Exo5 C A 4: 120,921,684 G328V probably damaging Het
Fam208a C T 14: 27,461,750 T722I probably benign Het
Fut9 A G 4: 25,620,811 M1T probably null Het
Galnt5 A G 2: 58,024,625 N584S possibly damaging Het
Gbp3 T C 3: 142,567,772 V360A probably damaging Het
Gdf6 G A 4: 9,859,977 C353Y probably damaging Het
Gm13089 A T 4: 143,698,503 D123E probably benign Het
Hace1 A G 10: 45,648,869 T244A probably damaging Het
Hr T C 14: 70,559,657 I500T probably benign Het
Ifnl2 A T 7: 28,509,282 L115Q probably damaging Het
Iigp1 T C 18: 60,389,824 F5L probably benign Het
Inhbb A G 1: 119,417,416 L381P probably damaging Het
Irx3 A T 8: 91,801,093 S50T probably benign Het
Ivns1abp C T 1: 151,360,145 T363I probably benign Het
Izumo1 A T 7: 45,622,899 T35S probably benign Het
Kank4 A G 4: 98,777,105 S651P probably damaging Het
Kit T C 5: 75,610,879 V232A probably benign Het
Klhl11 T C 11: 100,463,714 Y427C probably damaging Het
Laptm4b T A 15: 34,258,689 N36K probably damaging Het
Lrrk1 T C 7: 66,266,615 probably null Het
Mamdc4 G T 2: 25,564,193 Q1042K probably benign Het
Mical2 A G 7: 112,321,440 probably null Het
Ms4a3 C A 19: 11,631,361 V176F possibly damaging Het
Myo3a T C 2: 22,333,513 V427A probably benign Het
Myo3a A C 2: 22,396,299 E626D possibly damaging Het
Nckap5 A T 1: 126,027,288 L509* probably null Het
Ndufa5 A T 6: 24,519,249 D64E possibly damaging Het
Nedd4l T C 18: 65,208,461 Y753H probably damaging Het
Nynrin T C 14: 55,872,761 V1775A probably damaging Het
Olfr141 A G 2: 86,806,861 L46S probably damaging Het
Olfr292 T C 7: 86,694,876 V140A possibly damaging Het
Olfr694 A T 7: 106,688,998 H244Q probably damaging Het
Olfr735 T C 14: 50,345,926 Y141C probably damaging Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Oplah A G 15: 76,302,992 S570P probably benign Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Osbpl5 A T 7: 143,694,821 L644Q probably damaging Het
Pcdhb19 T C 18: 37,497,952 W267R probably benign Het
Pkhd1l1 A C 15: 44,467,424 S132R possibly damaging Het
Ptpn13 T A 5: 103,556,145 S1348T probably benign Het
Rc3h1 T A 1: 160,930,135 W8R probably damaging Het
Rgs3 T G 4: 62,625,936 V315G probably damaging Het
Rora T A 9: 69,361,869 M82K probably damaging Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Sag T C 1: 87,812,991 V45A probably damaging Het
Scn3a T C 2: 65,536,510 E56G probably damaging Het
Sec24c T G 14: 20,686,948 V324G probably damaging Het
Sptbn1 A G 11: 30,138,979 L748S probably damaging Het
Stard9 A T 2: 120,706,306 D4186V probably damaging Het
Stk39 T C 2: 68,366,167 E306G probably damaging Het
Sycp1 C A 3: 102,898,849 probably null Het
Taf2 A C 15: 55,060,050 L277R probably damaging Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tekt5 T C 16: 10,361,304 T400A possibly damaging Het
Tgfbrap1 T C 1: 43,060,141 H401R probably benign Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tln1 T G 4: 43,544,645 T1095P possibly damaging Het
Tmem147 A G 7: 30,728,102 Y72H probably benign Het
Tnfaip2 A G 12: 111,453,507 N691S probably benign Het
Trim24 G A 6: 37,957,783 C811Y probably damaging Het
Trim30b T A 7: 104,357,976 probably benign Het
Trpc4 T G 3: 54,194,768 L29R probably damaging Het
Trpm6 A T 19: 18,825,862 I890F probably damaging Het
Ttc23l C T 15: 10,504,536 E442K probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Ugt1a6a C A 1: 88,138,884 S137R probably benign Het
Unc13a A G 8: 71,658,467 Y367H probably damaging Het
Vmn2r49 A G 7: 9,976,306 I833T probably benign Het
Vmn2r7 T C 3: 64,716,479 D231G probably benign Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zcchc6 A T 13: 59,799,782 C506* probably null Het
Zfp804a G A 2: 82,257,588 S587N probably damaging Het
Zswim2 A G 2: 83,923,659 I219T probably benign Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 intron probably null
R6034:Cps1 UTSW 1 67157713 intron probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R7936:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGCTGAAGGGCCTGATGTGAACC -3'
(R):5'- CCTGGCAGCAAGCTCGTTAATAACC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtgtgAGATTC -3'
(R):5'- GCAAGCTCGTTAATAACCGTGTC -3'
Posted On2013-07-11