Mutagenetix > Incidental Mutations

Incidental Mutation 'R7003:Nt5e'

544676

Institutional Source

Beutler Lab

Gene Symbol

Nt5e

Ensembl Gene

ENSMUSG00000032420

Gene Name

5' nucleotidase, ecto

Synonyms

ecto-5'-nucleotidase, CD73, Nt5, 2210401F01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7003 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88327197-88372092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88364752 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 347 (Y347C)

Ref Sequence

ENSEMBL: ENSMUSP00000034992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034992]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034992
AA Change: Y347C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034992
Gene: ENSMUSG00000032420
AA Change: Y347C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Metallophos	31	248	2.1e-15	PFAM
Pfam:5_nucleotid_C	340	515	4.9e-45	PFAM
transmembrane domain	553	575	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a membrane-bound nucleotidase that hydrolyzes extracellular nucleoside monophosphates. The encoded preproprotein undergoes proteolytic processing to generate to a functional, homodimeric enzyme that preferentially uses adenosine monophosphate as a substrate to generate free adenosine. Mice lacking the encoded protein exhibit a significantly reduced fall in stop flow pressure and superficial nephron glomerular filtration rate in response to a saturating increase of tubular perfusion flow. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice for one allele are viable and fertile with increased circulating alkaline phosphatase and impaired tubuloglomerular feedback regulation. Homozygous null mice for a second allele display increased vascular permeability especially under hypoxic conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	G	15: 8,228,762	L2164R	probably damaging	Het
Actbl2	T	A	13: 111,255,956	I275N	probably damaging	Het
Actr3b	A	C	5: 25,798,463	Y21S	probably damaging	Het
Adam6b	C	T	12: 113,490,042	Q160*	probably null	Het
Adgrv1	C	T	13: 81,522,104		probably null	Het
Akr1c6	A	G	13: 4,454,515	N300D	probably benign	Het
Alox8	T	C	11: 69,191,590	D170G	possibly damaging	Het
Amhr2	A	G	15: 102,446,333	N40S	probably benign	Het
Ap2a2	A	G	7: 141,629,196	N767S	probably benign	Het
Armc3	T	C	2: 19,270,028	I358T	probably damaging	Het
Atg2b	A	G	12: 105,654,249	S732P	probably benign	Het
Atp12a	A	G	14: 56,373,380	Y327C	possibly damaging	Het
Bcr	T	C	10: 75,061,561	V179A	probably benign	Het
Cep104	T	C	4: 153,993,561	L642P	probably benign	Het
Clspn	T	A	4: 126,592,720	S1302R	possibly damaging	Het
Cmip	T	C	8: 117,384,988	F153L	probably benign	Het
D630039A03Rik	T	C	4: 57,910,521	D97G	probably damaging	Het
Dok7	A	T	5: 35,079,555	T396S	probably benign	Het
Dsel	C	T	1: 111,860,295	V837I	probably benign	Het
Etl4	C	T	2: 20,805,884	T926I	probably benign	Het
Gm7102	A	G	19: 61,175,881	S39P	possibly damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gpr155	A	G	2: 73,343,617	I816T	probably damaging	Het
Hpn	C	T	7: 31,110,942		probably benign	Het
Inpp5e	A	G	2: 26,397,865	S640P	probably benign	Het
Irs3	C	T	5: 137,645,277	V82I	probably benign	Het
Kif16b	A	C	2: 142,758,829	D461E	possibly damaging	Het
Krba1	A	G	6: 48,413,080	T592A	possibly damaging	Het
Lgsn	T	A	1: 31,203,943	S369T	possibly damaging	Het
Lrrc4b	C	T	7: 44,445,156	P83S	probably damaging	Het
Neil3	T	C	8: 53,600,966	T343A	possibly damaging	Het
Olfr1532-ps1	A	T	7: 106,915,112	T305S	probably benign	Het
Olfr3	A	G	2: 36,813,035	I19T	possibly damaging	Het
Olfr452	C	T	6: 42,790,465	T142I	probably benign	Het
Olfr943	A	T	9: 39,184,943	Y255F	probably benign	Het
P2rx5	T	C	11: 73,167,974		probably null	Het
Phtf2	A	G	5: 20,794,401	V248A	probably benign	Het
Plekhd1	T	C	12: 80,721,960	C406R	possibly damaging	Het
Plod3	T	A	5: 136,989,644	N245K	probably damaging	Het
Polr3c	G	T	3: 96,723,638	H155Q	possibly damaging	Het
Psap	T	A	10: 60,299,497	C317S	probably damaging	Het
Rif1	A	G	2: 52,076,989	I97V	probably benign	Het
Rnf123	T	A	9: 108,063,683		probably null	Het
Rnf19a	G	A	15: 36,254,504	R303*	probably null	Het
Sdk1	G	A	5: 142,096,734	V1036I	probably benign	Het
Shc3	T	A	13: 51,466,552	Y146F	probably benign	Het
Skint6	A	G	4: 113,105,912	Y441H	probably benign	Het
Slc7a12	T	C	3: 14,505,520	I173T	probably damaging	Het
Spesp1	A	T	9: 62,282,020	S15T	possibly damaging	Het
Tarm1	A	T	7: 3,497,423		probably null	Het
Tenm3	T	C	8: 48,240,444	Y1817C	probably damaging	Het
Ttc9c	A	T	19: 8,818,540	L45Q	probably damaging	Het
Ube3a	C	T	7: 59,276,440	T322I	probably damaging	Het
Vac14	T	A	8: 110,712,798	V669E	probably damaging	Het
Vmn1r225	A	G	17: 20,503,154	M286V	probably null	Het
Zfp658	A	G	7: 43,574,748	K816E	possibly damaging	Het
Zfp846	T	C	9: 20,587,892	M1T	probably null	Het

Other mutations in Nt5e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01794:Nt5e	APN	9	88367298	missense	probably damaging	0.97
IGL02015:Nt5e	APN	9	88367237	missense	probably damaging	1.00
IGL02351:Nt5e	APN	9	88327893	missense	probably damaging	1.00
IGL02358:Nt5e	APN	9	88327893	missense	probably damaging	1.00
IGL02826:Nt5e	APN	9	88355705	missense	probably damaging	0.97
IGL03237:Nt5e	APN	9	88355734	missense	probably damaging	1.00
R0092:Nt5e	UTSW	9	88370285	missense	probably benign	0.00
R0238:Nt5e	UTSW	9	88367332	missense	possibly damaging	0.81
R0238:Nt5e	UTSW	9	88367332	missense	possibly damaging	0.81
R0557:Nt5e	UTSW	9	88366466	missense	probably damaging	1.00
R1727:Nt5e	UTSW	9	88328029	missense	possibly damaging	0.87
R1834:Nt5e	UTSW	9	88370187	missense	probably damaging	1.00
R2361:Nt5e	UTSW	9	88370237	missense	possibly damaging	0.67
R3871:Nt5e	UTSW	9	88364693	missense	probably benign	0.04
R4990:Nt5e	UTSW	9	88355593	missense	probably benign	0.03
R5039:Nt5e	UTSW	9	88363581	missense	probably benign	0.00
R5642:Nt5e	UTSW	9	88327687	start codon destroyed	probably null	0.02
R5812:Nt5e	UTSW	9	88369055	missense	probably damaging	1.00
R6389:Nt5e	UTSW	9	88363471	missense	probably damaging	1.00
R8325:Nt5e	UTSW	9	88363562	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGATGTGAGCACCGCAAAGC -3'
(R):5'- CTTCTGTCTGGGCACAAAATG -3'

Sequencing Primer
(F):5'- GGAAGCCTGGCAAAACTCCATTTC -3'
(R):5'- AATGTGCCAAAGTCCCTAATTCTGC -3'

Posted On

2019-05-13