Mutagenetix > Incidental Mutation

Incidental Mutation 'R0609:Sag'

54469

Institutional Source

Beutler Lab

Gene Symbol

Sag

Ensembl Gene

ENSMUSG00000056055

Gene Name

S-antigen, retina and pineal gland (arrestin)

Synonyms

arrestin 1, A930001K18Rik, arrestin, visual arrestin 1, Arr1, rod arrestin

MMRRC Submission

038798-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0609 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87803680-87845158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87812991 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 45 (V45A)

Ref Sequence

ENSEMBL: ENSMUSP00000136729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]

AlphaFold

P20443

Predicted Effect

probably damaging
Transcript: ENSMUST00000077772
AA Change: V45A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055
AA Change: V45A

Domain	Start	End	E-Value	Type
Pfam:Arrestin_N	23	181	2.8e-36	PFAM
Arrestin_C	200	361	8.24e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128761

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130886

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155393

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156381

Predicted Effect

probably damaging
Transcript: ENSMUST00000177757
AA Change: V45A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055
AA Change: V45A

Domain	Start	End	E-Value	Type
Pfam:Arrestin_N	23	181	2.7e-34	PFAM
Arrestin_C	200	361	8.24e-30	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930596D02Rik	A	T	14: 35,811,461		probably null	Het
Abcb4	T	A	5: 8,947,376	C952S	probably damaging	Het
Adamtsl2	A	G	2: 27,089,635	D272G	probably benign	Het
Aim2	G	A	1: 173,461,964	D158N	probably damaging	Het
Aldh3b1	C	T	19: 3,914,024	R426H	probably damaging	Het
Apoc2	A	G	7: 19,673,353	S28P	probably benign	Het
Arfgef3	G	A	10: 18,597,431	T1628I	probably benign	Het
Atp10a	G	A	7: 58,819,740		probably null	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Bmp8b	T	A	4: 123,121,899	D226E	probably benign	Het
Brsk2	T	C	7: 141,998,492	Y618H	probably damaging	Het
Casp12	T	A	9: 5,346,554	F27Y	probably damaging	Het
Casp8	T	A	1: 58,844,792	N439K	probably benign	Het
Ccdc175	T	A	12: 72,157,507	K253N	probably benign	Het
Cdc42bpa	A	G	1: 180,040,179	H193R	probably damaging	Het
Cdk17	T	C	10: 93,216,472	M105T	probably benign	Het
Cdon	C	A	9: 35,478,611	P854T	probably damaging	Het
Cep44	A	G	8: 56,544,152	M117T	possibly damaging	Het
Cep89	A	T	7: 35,435,530	E674D	probably damaging	Het
Cit	C	T	5: 115,873,943	A203V	probably damaging	Het
Clstn1	C	A	4: 149,629,300		probably null	Het
Col7a1	T	A	9: 108,958,147	D565E	unknown	Het
Cpb1	T	A	3: 20,262,474	Y304F	probably damaging	Het
Cps1	T	G	1: 67,172,802	Y710D	probably damaging	Het
Creb3l1	T	C	2: 91,987,053	T372A	possibly damaging	Het
Dars	A	G	1: 128,405,381	V102A	probably benign	Het
Dhx35	C	T	2: 158,817,415	T168I	possibly damaging	Het
Dnah5	T	C	15: 28,327,779	S2100P	probably benign	Het
Dst	T	C	1: 34,266,960		probably null	Het
Egflam	A	C	15: 7,253,523	L351R	possibly damaging	Het
Elp2	T	A	18: 24,626,156	D523E	probably benign	Het
Exo5	C	A	4: 120,921,684	G328V	probably damaging	Het
Fam208a	C	T	14: 27,461,750	T722I	probably benign	Het
Fut9	A	G	4: 25,620,811	M1T	probably null	Het
Galnt5	A	G	2: 58,024,625	N584S	possibly damaging	Het
Gbp3	T	C	3: 142,567,772	V360A	probably damaging	Het
Gdf6	G	A	4: 9,859,977	C353Y	probably damaging	Het
Gm13089	A	T	4: 143,698,503	D123E	probably benign	Het
Hace1	A	G	10: 45,648,869	T244A	probably damaging	Het
Hr	T	C	14: 70,559,657	I500T	probably benign	Het
Ifnl2	A	T	7: 28,509,282	L115Q	probably damaging	Het
Iigp1	T	C	18: 60,389,824	F5L	probably benign	Het
Inhbb	A	G	1: 119,417,416	L381P	probably damaging	Het
Irx3	A	T	8: 91,801,093	S50T	probably benign	Het
Ivns1abp	C	T	1: 151,360,145	T363I	probably benign	Het
Izumo1	A	T	7: 45,622,899	T35S	probably benign	Het
Kank4	A	G	4: 98,777,105	S651P	probably damaging	Het
Kit	T	C	5: 75,610,879	V232A	probably benign	Het
Klhl11	T	C	11: 100,463,714	Y427C	probably damaging	Het
Laptm4b	T	A	15: 34,258,689	N36K	probably damaging	Het
Lrrk1	T	C	7: 66,266,615		probably null	Het
Mamdc4	G	T	2: 25,564,193	Q1042K	probably benign	Het
Mical2	A	G	7: 112,321,440		probably null	Het
Ms4a3	C	A	19: 11,631,361	V176F	possibly damaging	Het
Myo3a	T	C	2: 22,333,513	V427A	probably benign	Het
Myo3a	A	C	2: 22,396,299	E626D	possibly damaging	Het
Nckap5	A	T	1: 126,027,288	L509*	probably null	Het
Ndufa5	A	T	6: 24,519,249	D64E	possibly damaging	Het
Nedd4l	T	C	18: 65,208,461	Y753H	probably damaging	Het
Nynrin	T	C	14: 55,872,761	V1775A	probably damaging	Het
Olfr141	A	G	2: 86,806,861	L46S	probably damaging	Het
Olfr292	T	C	7: 86,694,876	V140A	possibly damaging	Het
Olfr694	A	T	7: 106,688,998	H244Q	probably damaging	Het
Olfr735	T	C	14: 50,345,926	Y141C	probably damaging	Het
Olfr823	G	A	10: 130,112,580	S70F	probably damaging	Het
Oplah	A	G	15: 76,302,992	S570P	probably benign	Het
Osbpl11	C	A	16: 33,234,444	Y632*	probably null	Het
Osbpl5	A	T	7: 143,694,821	L644Q	probably damaging	Het
Pcdhb19	T	C	18: 37,497,952	W267R	probably benign	Het
Pkhd1l1	A	C	15: 44,467,424	S132R	possibly damaging	Het
Ptpn13	T	A	5: 103,556,145	S1348T	probably benign	Het
Rc3h1	T	A	1: 160,930,135	W8R	probably damaging	Het
Rgs3	T	G	4: 62,625,936	V315G	probably damaging	Het
Rora	T	A	9: 69,361,869	M82K	probably damaging	Het
Rph3al	T	C	11: 75,908,969	I55V	probably benign	Het
Scn3a	T	C	2: 65,536,510	E56G	probably damaging	Het
Sec24c	T	G	14: 20,686,948	V324G	probably damaging	Het
Sptbn1	A	G	11: 30,138,979	L748S	probably damaging	Het
Stard9	A	T	2: 120,706,306	D4186V	probably damaging	Het
Stk39	T	C	2: 68,366,167	E306G	probably damaging	Het
Sycp1	C	A	3: 102,898,849		probably null	Het
Taf2	A	C	15: 55,060,050	L277R	probably damaging	Het
Tbc1d23	T	A	16: 57,173,106	I566F	possibly damaging	Het
Tekt5	T	C	16: 10,361,304	T400A	possibly damaging	Het
Tgfbrap1	T	C	1: 43,060,141	H401R	probably benign	Het
Tie1	T	A	4: 118,476,147	I841L	possibly damaging	Het
Tln1	T	G	4: 43,544,645	T1095P	possibly damaging	Het
Tmem147	A	G	7: 30,728,102	Y72H	probably benign	Het
Tnfaip2	A	G	12: 111,453,507	N691S	probably benign	Het
Trim24	G	A	6: 37,957,783	C811Y	probably damaging	Het
Trim30b	T	A	7: 104,357,976		probably benign	Het
Trpc4	T	G	3: 54,194,768	L29R	probably damaging	Het
Trpm6	A	T	19: 18,825,862	I890F	probably damaging	Het
Ttc23l	C	T	15: 10,504,536	E442K	probably benign	Het
Uggt2	A	G	14: 119,095,336	V62A	probably damaging	Het
Ugt1a6a	C	A	1: 88,138,884	S137R	probably benign	Het
Unc13a	A	G	8: 71,658,467	Y367H	probably damaging	Het
Vmn2r49	A	G	7: 9,976,306	I833T	probably benign	Het
Vmn2r7	T	C	3: 64,716,479	D231G	probably benign	Het
Ythdc2	A	T	18: 44,864,357	M994L	probably benign	Het
Zcchc6	A	T	13: 59,799,782	C506*	probably null	Het
Zfp804a	G	A	2: 82,257,588	S587N	probably damaging	Het
Zswim2	A	G	2: 83,923,659	I219T	probably benign	Het

Other mutations in Sag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Sag	APN	1	87824424	critical splice acceptor site	probably null
IGL00822:Sag	APN	1	87845026	splice site	probably null
IGL01140:Sag	APN	1	87823364	missense	probably benign	0.22
IGL01612:Sag	APN	1	87805349	missense	probably damaging	0.98
IGL02183:Sag	APN	1	87828475	splice site	probably null
IGL02893:Sag	APN	1	87834593	missense	probably benign	0.01
R0049:Sag	UTSW	1	87834618	missense	probably damaging	0.99
R0049:Sag	UTSW	1	87834618	missense	probably damaging	0.99
R0091:Sag	UTSW	1	87814680	missense	probably damaging	0.96
R0531:Sag	UTSW	1	87834629	critical splice donor site	probably null
R1328:Sag	UTSW	1	87810294	splice site	probably benign
R1395:Sag	UTSW	1	87828441	missense	probably benign	0.01
R1748:Sag	UTSW	1	87831940	missense	probably damaging	1.00
R1858:Sag	UTSW	1	87814848	missense	probably benign
R2020:Sag	UTSW	1	87805315	missense	probably damaging	1.00
R3854:Sag	UTSW	1	87824518	splice site	probably benign
R4021:Sag	UTSW	1	87821305	critical splice acceptor site	probably null
R4298:Sag	UTSW	1	87845015	missense	probably benign
R4630:Sag	UTSW	1	87834618	missense	probably damaging	0.99
R5352:Sag	UTSW	1	87812993	missense	probably benign	0.01
R5680:Sag	UTSW	1	87821337	missense	possibly damaging	0.83
R6164:Sag	UTSW	1	87824453	missense	probably damaging	1.00
R6407:Sag	UTSW	1	87814806	missense	probably benign
R7431:Sag	UTSW	1	87821337	missense	possibly damaging	0.83
R7548:Sag	UTSW	1	87844916	missense	probably benign	0.01
R8122:Sag	UTSW	1	87834567	missense	probably damaging	1.00
R8679:Sag	UTSW	1	87810310	missense	probably benign	0.27
R8723:Sag	UTSW	1	87823453	critical splice donor site	probably null
R8878:Sag	UTSW	1	87828436	missense	probably benign	0.01
R8891:Sag	UTSW	1	87831961	missense	probably damaging	1.00
R8995:Sag	UTSW	1	87805330	missense	probably benign	0.00
R9036:Sag	UTSW	1	87821332	missense	probably damaging	1.00
R9123:Sag	UTSW	1	87823321	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAAGCTGGATGGTGAATCAGG -3'
(R):5'- GCACTGTGATACTGTGGCACAGA -3'

Sequencing Primer
(F):5'- ggcaggaggattacttgtttatg -3'
(R):5'- ACTGTGGCACAGAACTTTGC -3'

Posted On

2013-07-11