Incidental Mutation 'R7006:Tanc1'
ID 544703
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Name tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms 1200003E16Rik
MMRRC Submission 045011-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 59442386-59676493 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59626188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 515 (V515A)
Ref Sequence ENSEMBL: ENSMUSP00000123345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
AlphaFold Q0VGY8
Predicted Effect probably damaging
Transcript: ENSMUST00000037526
AA Change: V515A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: V515A

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112568
AA Change: V508A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: V508A

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139863
AA Change: V515A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: V515A

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 A G 4: 144,447,853 (GRCm39) V41A probably benign Het
Adcy2 G A 13: 69,036,139 (GRCm39) T174M probably damaging Het
Ankfy1 T A 11: 72,631,290 (GRCm39) I412N probably benign Het
AW146154 T C 7: 41,130,648 (GRCm39) E156G possibly damaging Het
B4galnt1 T C 10: 127,005,700 (GRCm39) L267P probably benign Het
Bod1l T C 5: 41,989,895 (GRCm39) E276G probably damaging Het
Ccdc187 T C 2: 26,171,102 (GRCm39) T459A probably benign Het
Ccdc196 T A 12: 78,255,702 (GRCm39) *177R probably null Het
Cep72 G A 13: 74,198,427 (GRCm39) Q311* probably null Het
Cir1 T C 2: 73,140,834 (GRCm39) Q45R probably damaging Het
Ciz1 T C 2: 32,261,127 (GRCm39) probably null Het
Crtap G T 9: 114,215,391 (GRCm39) A166E probably damaging Het
Dipk1a A G 5: 108,058,027 (GRCm39) V132A probably benign Het
Dmp1 A G 5: 104,360,188 (GRCm39) D288G probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Fmnl2 C A 2: 52,998,266 (GRCm39) Q544K probably benign Het
Gpsm1 T C 2: 26,212,572 (GRCm39) L72P probably damaging Het
Gys1 G A 7: 45,089,437 (GRCm39) A199T probably damaging Het
Kcnq3 A C 15: 65,892,165 (GRCm39) Y403* probably null Het
Kcp A C 6: 29,499,169 (GRCm39) Y298D probably damaging Het
Kif5c T C 2: 49,625,526 (GRCm39) S599P probably damaging Het
Krt20 A T 11: 99,328,587 (GRCm39) Y113N probably benign Het
Mcm8 T G 2: 132,665,181 (GRCm39) V191G probably damaging Het
Msr1 T A 8: 40,042,423 (GRCm39) D384V probably damaging Het
Mtpap A C 18: 4,380,873 (GRCm39) S184R possibly damaging Het
Npc1l1 G A 11: 6,167,731 (GRCm39) T1020M probably benign Het
Nphp4 A G 4: 152,573,259 (GRCm39) T66A probably benign Het
Or1o3 T A 17: 37,573,625 (GRCm39) *310L probably null Het
Or4f14 C A 2: 111,742,601 (GRCm39) V225L probably benign Het
Or8h10 G A 2: 86,808,303 (GRCm39) T279I probably damaging Het
Or8k18 T A 2: 86,085,572 (GRCm39) Q155L probably benign Het
Phf11d G T 14: 59,590,823 (GRCm39) T178K probably benign Het
Ppm1d A G 11: 85,227,977 (GRCm39) K298E possibly damaging Het
Rab2b A T 14: 52,503,690 (GRCm39) I144K probably benign Het
Stoml1 A G 9: 58,167,523 (GRCm39) D5G probably damaging Het
Styxl2 T C 1: 165,926,663 (GRCm39) N983S probably benign Het
Tas1r3 A G 4: 155,947,361 (GRCm39) V108A possibly damaging Het
Tifab T C 13: 56,324,059 (GRCm39) Y128C probably benign Het
Tmc6 G T 11: 117,665,083 (GRCm39) R397S probably damaging Het
Tnpo3 C T 6: 29,589,162 (GRCm39) A63T probably damaging Het
Trgc4 T A 13: 19,528,995 (GRCm39) probably benign Het
Usp16 G T 16: 87,268,724 (GRCm39) C284F probably damaging Het
Wipf1 T C 2: 73,267,441 (GRCm39) D319G probably damaging Het
Xpnpep3 T A 15: 81,326,649 (GRCm39) W347R probably damaging Het
Zfp180 G T 7: 23,804,537 (GRCm39) E319* probably null Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59,621,185 (GRCm39) missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59,623,520 (GRCm39) missense probably benign 0.00
IGL00688:Tanc1 APN 2 59,645,735 (GRCm39) missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59,636,645 (GRCm39) missense probably benign 0.15
IGL01576:Tanc1 APN 2 59,628,079 (GRCm39) missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59,615,817 (GRCm39) missense probably benign
IGL02016:Tanc1 APN 2 59,673,934 (GRCm39) missense probably benign 0.00
IGL02373:Tanc1 APN 2 59,626,372 (GRCm39) critical splice donor site probably null
IGL02539:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59,554,998 (GRCm39) splice site probably benign
IGL02626:Tanc1 APN 2 59,630,216 (GRCm39) missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59,630,330 (GRCm39) missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59,623,431 (GRCm39) splice site probably benign
Oreja UTSW 2 59,622,148 (GRCm39) synonymous silent
R0178:Tanc1 UTSW 2 59,665,791 (GRCm39) nonsense probably null
R0347:Tanc1 UTSW 2 59,673,335 (GRCm39) missense probably benign
R0570:Tanc1 UTSW 2 59,626,382 (GRCm39) splice site probably benign
R0660:Tanc1 UTSW 2 59,674,228 (GRCm39) nonsense probably null
R0664:Tanc1 UTSW 2 59,674,228 (GRCm39) nonsense probably null
R0898:Tanc1 UTSW 2 59,621,132 (GRCm39) missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59,673,835 (GRCm39) missense probably benign
R1575:Tanc1 UTSW 2 59,621,995 (GRCm39) missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59,628,038 (GRCm39) missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59,615,731 (GRCm39) missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59,673,365 (GRCm39) missense probably benign 0.02
R1727:Tanc1 UTSW 2 59,621,153 (GRCm39) missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59,630,441 (GRCm39) missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59,622,023 (GRCm39) missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59,555,095 (GRCm39) missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59,622,156 (GRCm39) missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59,674,177 (GRCm39) missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59,555,068 (GRCm39) missense probably benign 0.04
R2267:Tanc1 UTSW 2 59,667,563 (GRCm39) critical splice donor site probably null
R4191:Tanc1 UTSW 2 59,669,357 (GRCm39) missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59,672,340 (GRCm39) splice site probably null
R4632:Tanc1 UTSW 2 59,626,179 (GRCm39) missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59,529,766 (GRCm39) missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59,630,287 (GRCm39) missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59,626,178 (GRCm39) missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59,665,051 (GRCm39) splice site probably null
R5672:Tanc1 UTSW 2 59,602,697 (GRCm39) missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59,626,341 (GRCm39) missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59,588,874 (GRCm39) missense probably benign
R5778:Tanc1 UTSW 2 59,529,691 (GRCm39) critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59,637,926 (GRCm39) missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59,615,685 (GRCm39) missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59,630,248 (GRCm39) missense probably benign 0.00
R5912:Tanc1 UTSW 2 59,622,030 (GRCm39) missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59,667,564 (GRCm39) critical splice donor site probably null
R6057:Tanc1 UTSW 2 59,647,837 (GRCm39) missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59,663,566 (GRCm39) nonsense probably null
R6179:Tanc1 UTSW 2 59,673,320 (GRCm39) missense probably benign 0.42
R6185:Tanc1 UTSW 2 59,621,929 (GRCm39) splice site probably null
R6192:Tanc1 UTSW 2 59,669,305 (GRCm39) splice site probably null
R6196:Tanc1 UTSW 2 59,674,366 (GRCm39) missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59,674,366 (GRCm39) missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59,672,375 (GRCm39) missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59,673,854 (GRCm39) missense probably benign 0.22
R6415:Tanc1 UTSW 2 59,667,458 (GRCm39) missense probably benign 0.02
R6480:Tanc1 UTSW 2 59,637,986 (GRCm39) missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59,626,298 (GRCm39) missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59,622,150 (GRCm39) missense probably benign 0.00
R7133:Tanc1 UTSW 2 59,627,953 (GRCm39) missense probably benign 0.16
R7381:Tanc1 UTSW 2 59,615,670 (GRCm39) missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59,636,688 (GRCm39) missense probably benign 0.02
R8392:Tanc1 UTSW 2 59,636,651 (GRCm39) missense probably damaging 0.99
R8692:Tanc1 UTSW 2 59,673,989 (GRCm39) missense probably benign 0.01
R8730:Tanc1 UTSW 2 59,601,590 (GRCm39) missense probably benign 0.00
R8731:Tanc1 UTSW 2 59,673,596 (GRCm39) missense probably benign 0.01
R8813:Tanc1 UTSW 2 59,630,265 (GRCm39) missense probably damaging 1.00
R8815:Tanc1 UTSW 2 59,621,185 (GRCm39) missense possibly damaging 0.84
R8933:Tanc1 UTSW 2 59,615,800 (GRCm39) missense possibly damaging 0.92
R9015:Tanc1 UTSW 2 59,622,224 (GRCm39) missense probably benign
R9042:Tanc1 UTSW 2 59,673,766 (GRCm39) missense probably benign 0.00
R9154:Tanc1 UTSW 2 59,630,132 (GRCm39) missense probably damaging 1.00
R9269:Tanc1 UTSW 2 59,630,432 (GRCm39) missense probably damaging 1.00
R9283:Tanc1 UTSW 2 59,630,174 (GRCm39) missense probably damaging 0.99
R9380:Tanc1 UTSW 2 59,665,796 (GRCm39) missense probably damaging 1.00
R9422:Tanc1 UTSW 2 59,637,933 (GRCm39) missense probably benign 0.08
R9428:Tanc1 UTSW 2 59,601,548 (GRCm39) missense probably damaging 1.00
R9694:Tanc1 UTSW 2 59,626,196 (GRCm39) missense probably damaging 1.00
RF028:Tanc1 UTSW 2 59,673,613 (GRCm39) small deletion probably benign
RF049:Tanc1 UTSW 2 59,673,613 (GRCm39) small deletion probably benign
X0063:Tanc1 UTSW 2 59,674,324 (GRCm39) nonsense probably null
X0064:Tanc1 UTSW 2 59,674,456 (GRCm39) missense probably damaging 1.00
Z1176:Tanc1 UTSW 2 59,602,873 (GRCm39) missense possibly damaging 0.93
Z1177:Tanc1 UTSW 2 59,622,174 (GRCm39) missense probably damaging 1.00
Z1177:Tanc1 UTSW 2 59,621,231 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTCTAGGGACCAGACACACTC -3'
(R):5'- ATCGGCCTTTACTGGGAAGC -3'

Sequencing Primer
(F):5'- ACACTCTGTGTCTTATCTCGGGAAG -3'
(R):5'- CCAAGGCTTCTGGTAGGTAC -3'
Posted On 2019-05-13