Mutagenetix > Incidental Mutations

Incidental Mutation 'R7006:Tanc1'

544703

Institutional Source

Beutler Lab

Gene Symbol

Tanc1

Ensembl Gene

ENSMUSG00000035168

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1

Synonyms

1200003E16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7006 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59612042-59846149 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59795844 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 515 (V515A)

Ref Sequence

ENSEMBL: ENSMUSP00000123345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037526
AA Change: V515A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: V515A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112568
AA Change: V508A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: V508A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	432	444	N/A	INTRINSIC
low complexity region	448	468	N/A	INTRINSIC
ANK	886	918	1.06e3	SMART
ANK	922	953	2.43e3	SMART
ANK	957	986	1.12e-3	SMART
Blast:ANK	990	1021	7e-12	BLAST
ANK	1030	1059	1.78e3	SMART
ANK	1068	1097	2.34e-1	SMART
ANK	1101	1130	3.71e-4	SMART
ANK	1134	1163	1.51e-4	SMART
ANK	1167	1196	4.89e-4	SMART
ANK	1200	1229	3.01e-4	SMART
ANK	1233	1262	1.99e2	SMART
TPR	1279	1312	7.49e1	SMART
TPR	1326	1359	2.35e-1	SMART
TPR	1360	1393	6.29e-2	SMART
low complexity region	1409	1425	N/A	INTRINSIC
low complexity region	1447	1476	N/A	INTRINSIC
low complexity region	1649	1679	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139863
AA Change: V515A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: V515A

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	60	78	N/A	INTRINSIC
low complexity region	171	191	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	439	451	N/A	INTRINSIC
low complexity region	455	475	N/A	INTRINSIC
ANK	893	925	1.06e3	SMART
ANK	929	960	2.43e3	SMART
ANK	964	993	1.12e-3	SMART
Blast:ANK	997	1028	7e-12	BLAST
ANK	1037	1066	1.78e3	SMART
ANK	1075	1104	2.34e-1	SMART
ANK	1108	1137	3.71e-4	SMART
ANK	1141	1170	1.51e-4	SMART
ANK	1174	1203	4.89e-4	SMART
ANK	1207	1236	3.01e-4	SMART
ANK	1240	1269	1.99e2	SMART
TPR	1286	1319	7.49e1	SMART
TPR	1333	1366	2.35e-1	SMART
TPR	1367	1400	6.29e-2	SMART
low complexity region	1416	1432	N/A	INTRINSIC
low complexity region	1454	1483	N/A	INTRINSIC
low complexity region	1656	1686	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy2	G	A	13: 68,888,020	T174M	probably damaging	Het
Ankfy1	T	A	11: 72,740,464	I412N	probably benign	Het
AW146154	T	C	7: 41,481,224	E156G	possibly damaging	Het
B4galnt1	T	C	10: 127,169,831	L267P	probably benign	Het
Bod1l	T	C	5: 41,832,552	E276G	probably damaging	Het
Ccdc187	T	C	2: 26,281,090	T459A	probably benign	Het
Cep72	G	A	13: 74,050,308	Q311*	probably null	Het
Cir1	T	C	2: 73,310,490	Q45R	probably damaging	Het
Ciz1	T	C	2: 32,371,115		probably null	Het
Crtap	G	T	9: 114,386,323	A166E	probably damaging	Het
Dmp1	A	G	5: 104,212,322	D288G	probably benign	Het
Dusp27	T	C	1: 166,099,094	N983S	probably benign	Het
Fam69a	A	G	5: 107,910,161	V132A	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Fmnl2	C	A	2: 53,108,254	Q544K	probably benign	Het
Gm13178	A	G	4: 144,721,283	V41A	probably benign	Het
Gm6657	T	A	12: 78,208,928	*177R	probably null	Het
Gpsm1	T	C	2: 26,322,560	L72P	probably damaging	Het
Gys1	G	A	7: 45,440,013	A199T	probably damaging	Het
Kcnq3	A	C	15: 66,020,316	Y403*	probably null	Het
Kcp	A	C	6: 29,499,170	Y298D	probably damaging	Het
Kif5c	T	C	2: 49,735,514	S599P	probably damaging	Het
Krt20	A	T	11: 99,437,761	Y113N	probably benign	Het
Mcm8	T	G	2: 132,823,261	V191G	probably damaging	Het
Msr1	T	A	8: 39,589,382	D384V	probably damaging	Het
Mtpap	A	C	18: 4,380,873	S184R	possibly damaging	Het
Npc1l1	G	A	11: 6,217,731	T1020M	probably benign	Het
Nphp4	A	G	4: 152,488,802	T66A	probably benign	Het
Olfr1049	T	A	2: 86,255,228	Q155L	probably benign	Het
Olfr1100	G	A	2: 86,977,959	T279I	probably damaging	Het
Olfr1306	C	A	2: 111,912,256	V225L	probably benign	Het
Olfr98	T	A	17: 37,262,734	*310L	probably null	Het
Phf11d	G	T	14: 59,353,374	T178K	probably benign	Het
Ppm1d	A	G	11: 85,337,151	K298E	possibly damaging	Het
Rab2b	A	T	14: 52,266,233	I144K	probably benign	Het
Stoml1	A	G	9: 58,260,240	D5G	probably damaging	Het
Tas1r3	A	G	4: 155,862,904	V108A	possibly damaging	Het
Tcrg-C4	T	A	13: 19,344,825		probably benign	Het
Tifab	T	C	13: 56,176,246	Y128C	probably benign	Het
Tmc6	G	T	11: 117,774,257	R397S	probably damaging	Het
Tnpo3	C	T	6: 29,589,163	A63T	probably damaging	Het
Usp16	G	T	16: 87,471,836	C284F	probably damaging	Het
Wipf1	T	C	2: 73,437,097	D319G	probably damaging	Het
Xpnpep3	T	A	15: 81,442,448	W347R	probably damaging	Het
Zfp180	G	T	7: 24,105,112	E319*	probably null	Het

Other mutations in Tanc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Tanc1	APN	2	59790841	missense	possibly damaging	0.84
IGL00484:Tanc1	APN	2	59793176	missense	probably benign	0.00
IGL00688:Tanc1	APN	2	59815391	missense	probably damaging	1.00
IGL00765:Tanc1	APN	2	59806301	missense	probably benign	0.15
IGL01576:Tanc1	APN	2	59797735	missense	probably damaging	1.00
IGL01590:Tanc1	APN	2	59785473	missense	probably benign
IGL02016:Tanc1	APN	2	59843590	missense	probably benign	0.00
IGL02373:Tanc1	APN	2	59796028	critical splice donor site	probably null
IGL02539:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02540:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02541:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02543:Tanc1	APN	2	59833258	missense	probably damaging	1.00
IGL02559:Tanc1	APN	2	59724654	splice site	probably benign
IGL02626:Tanc1	APN	2	59799872	missense	probably damaging	1.00
IGL02669:Tanc1	APN	2	59799986	missense	probably damaging	1.00
IGL02902:Tanc1	APN	2	59793087	splice site	probably benign
Oreja	UTSW	2	59791804	synonymous	silent
R0178:Tanc1	UTSW	2	59835447	nonsense	probably null
R0347:Tanc1	UTSW	2	59842991	missense	probably benign
R0570:Tanc1	UTSW	2	59796038	splice site	probably benign
R0660:Tanc1	UTSW	2	59843884	nonsense	probably null
R0664:Tanc1	UTSW	2	59843884	nonsense	probably null
R0898:Tanc1	UTSW	2	59790788	missense	probably damaging	1.00
R1333:Tanc1	UTSW	2	59843491	missense	probably benign
R1575:Tanc1	UTSW	2	59791651	missense	probably damaging	1.00
R1608:Tanc1	UTSW	2	59797694	missense	possibly damaging	0.80
R1616:Tanc1	UTSW	2	59785387	missense	probably damaging	1.00
R1703:Tanc1	UTSW	2	59843021	missense	probably benign	0.02
R1727:Tanc1	UTSW	2	59790809	missense	probably damaging	1.00
R1809:Tanc1	UTSW	2	59800097	missense	probably damaging	1.00
R1812:Tanc1	UTSW	2	59791679	missense	probably damaging	1.00
R1925:Tanc1	UTSW	2	59724751	missense	possibly damaging	0.48
R1951:Tanc1	UTSW	2	59791812	missense	possibly damaging	0.92
R2174:Tanc1	UTSW	2	59843833	missense	possibly damaging	0.72
R2228:Tanc1	UTSW	2	59724724	missense	probably benign	0.04
R2267:Tanc1	UTSW	2	59837219	critical splice donor site	probably null
R4191:Tanc1	UTSW	2	59839013	missense	probably damaging	1.00
R4476:Tanc1	UTSW	2	59841996	splice site	probably null
R4632:Tanc1	UTSW	2	59795835	missense	probably damaging	1.00
R4825:Tanc1	UTSW	2	59699422	missense	probably damaging	1.00
R4982:Tanc1	UTSW	2	59799943	missense	probably damaging	1.00
R5338:Tanc1	UTSW	2	59795834	missense	probably damaging	1.00
R5657:Tanc1	UTSW	2	59834707	splice site	probably null
R5672:Tanc1	UTSW	2	59772353	missense	possibly damaging	0.81
R5703:Tanc1	UTSW	2	59795997	missense	probably damaging	0.98
R5707:Tanc1	UTSW	2	59758530	missense	probably benign
R5778:Tanc1	UTSW	2	59699347	critical splice acceptor site	probably null
R5795:Tanc1	UTSW	2	59807582	missense	possibly damaging	0.62
R5831:Tanc1	UTSW	2	59785341	missense	possibly damaging	0.89
R5849:Tanc1	UTSW	2	59799904	missense	probably benign	0.00
R5912:Tanc1	UTSW	2	59791686	missense	possibly damaging	0.92
R5944:Tanc1	UTSW	2	59837220	critical splice donor site	probably null
R6057:Tanc1	UTSW	2	59817493	missense	possibly damaging	0.46
R6142:Tanc1	UTSW	2	59833222	nonsense	probably null
R6179:Tanc1	UTSW	2	59842976	missense	probably benign	0.42
R6185:Tanc1	UTSW	2	59791585	splice site	probably null
R6192:Tanc1	UTSW	2	59838961	splice site	probably null
R6196:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6197:Tanc1	UTSW	2	59844022	missense	possibly damaging	0.94
R6230:Tanc1	UTSW	2	59842031	missense	probably damaging	1.00
R6275:Tanc1	UTSW	2	59843510	missense	probably benign	0.22
R6415:Tanc1	UTSW	2	59837114	missense	probably benign	0.02
R6480:Tanc1	UTSW	2	59807642	missense	probably damaging	1.00
R6578:Tanc1	UTSW	2	59795954	missense	probably damaging	1.00
R6786:Tanc1	UTSW	2	59791806	missense	probably benign	0.00
R7133:Tanc1	UTSW	2	59797609	missense	probably benign	0.16
R7381:Tanc1	UTSW	2	59785326	missense	probably damaging	1.00
R7422:Tanc1	UTSW	2	59806344	missense	probably benign	0.02
X0063:Tanc1	UTSW	2	59843980	nonsense	probably null
X0064:Tanc1	UTSW	2	59844112	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCTAGGGACCAGACACACTC -3'
(R):5'- ATCGGCCTTTACTGGGAAGC -3'

Sequencing Primer
(F):5'- ACACTCTGTGTCTTATCTCGGGAAG -3'
(R):5'- CCAAGGCTTCTGGTAGGTAC -3'

Posted On

2019-05-13