Incidental Mutation 'R7006:Cir1'
ID 544704
Institutional Source Beutler Lab
Gene Symbol Cir1
Ensembl Gene ENSMUSG00000041777
Gene Name corepressor interacting with RBPJ, 1
Synonyms CIR, 2810021A19Rik, 1700023B02Rik
MMRRC Submission 045011-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 73113445-73142922 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73140834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 45 (Q45R)
Ref Sequence ENSEMBL: ENSMUSP00000049834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058615] [ENSMUST00000090811] [ENSMUST00000112050]
AlphaFold Q9DA19
Predicted Effect probably damaging
Transcript: ENSMUST00000058615
AA Change: Q45R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049834
Gene: ENSMUSG00000041777
AA Change: Q45R

DomainStartEndE-ValueType
Cir_N 13 49 6.03e-14 SMART
low complexity region 79 97 N/A INTRINSIC
Blast:ZnF_C2HC 127 145 9e-6 BLAST
coiled coil region 213 261 N/A INTRINSIC
low complexity region 385 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090811
SMART Domains Protein: ENSMUSP00000088320
Gene: ENSMUSG00000008226

DomainStartEndE-ValueType
Pfam:Peptidase_C69 50 268 4.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112050
SMART Domains Protein: ENSMUSP00000107681
Gene: ENSMUSG00000008226

DomainStartEndE-ValueType
Pfam:Peptidase_C69 14 185 9.3e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 A G 4: 144,447,853 (GRCm39) V41A probably benign Het
Adcy2 G A 13: 69,036,139 (GRCm39) T174M probably damaging Het
Ankfy1 T A 11: 72,631,290 (GRCm39) I412N probably benign Het
AW146154 T C 7: 41,130,648 (GRCm39) E156G possibly damaging Het
B4galnt1 T C 10: 127,005,700 (GRCm39) L267P probably benign Het
Bod1l T C 5: 41,989,895 (GRCm39) E276G probably damaging Het
Ccdc187 T C 2: 26,171,102 (GRCm39) T459A probably benign Het
Ccdc196 T A 12: 78,255,702 (GRCm39) *177R probably null Het
Cep72 G A 13: 74,198,427 (GRCm39) Q311* probably null Het
Ciz1 T C 2: 32,261,127 (GRCm39) probably null Het
Crtap G T 9: 114,215,391 (GRCm39) A166E probably damaging Het
Dipk1a A G 5: 108,058,027 (GRCm39) V132A probably benign Het
Dmp1 A G 5: 104,360,188 (GRCm39) D288G probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Fmnl2 C A 2: 52,998,266 (GRCm39) Q544K probably benign Het
Gpsm1 T C 2: 26,212,572 (GRCm39) L72P probably damaging Het
Gys1 G A 7: 45,089,437 (GRCm39) A199T probably damaging Het
Kcnq3 A C 15: 65,892,165 (GRCm39) Y403* probably null Het
Kcp A C 6: 29,499,169 (GRCm39) Y298D probably damaging Het
Kif5c T C 2: 49,625,526 (GRCm39) S599P probably damaging Het
Krt20 A T 11: 99,328,587 (GRCm39) Y113N probably benign Het
Mcm8 T G 2: 132,665,181 (GRCm39) V191G probably damaging Het
Msr1 T A 8: 40,042,423 (GRCm39) D384V probably damaging Het
Mtpap A C 18: 4,380,873 (GRCm39) S184R possibly damaging Het
Npc1l1 G A 11: 6,167,731 (GRCm39) T1020M probably benign Het
Nphp4 A G 4: 152,573,259 (GRCm39) T66A probably benign Het
Or1o3 T A 17: 37,573,625 (GRCm39) *310L probably null Het
Or4f14 C A 2: 111,742,601 (GRCm39) V225L probably benign Het
Or8h10 G A 2: 86,808,303 (GRCm39) T279I probably damaging Het
Or8k18 T A 2: 86,085,572 (GRCm39) Q155L probably benign Het
Phf11d G T 14: 59,590,823 (GRCm39) T178K probably benign Het
Ppm1d A G 11: 85,227,977 (GRCm39) K298E possibly damaging Het
Rab2b A T 14: 52,503,690 (GRCm39) I144K probably benign Het
Stoml1 A G 9: 58,167,523 (GRCm39) D5G probably damaging Het
Styxl2 T C 1: 165,926,663 (GRCm39) N983S probably benign Het
Tanc1 T C 2: 59,626,188 (GRCm39) V515A probably damaging Het
Tas1r3 A G 4: 155,947,361 (GRCm39) V108A possibly damaging Het
Tifab T C 13: 56,324,059 (GRCm39) Y128C probably benign Het
Tmc6 G T 11: 117,665,083 (GRCm39) R397S probably damaging Het
Tnpo3 C T 6: 29,589,162 (GRCm39) A63T probably damaging Het
Trgc4 T A 13: 19,528,995 (GRCm39) probably benign Het
Usp16 G T 16: 87,268,724 (GRCm39) C284F probably damaging Het
Wipf1 T C 2: 73,267,441 (GRCm39) D319G probably damaging Het
Xpnpep3 T A 15: 81,326,649 (GRCm39) W347R probably damaging Het
Zfp180 G T 7: 23,804,537 (GRCm39) E319* probably null Het
Other mutations in Cir1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Cir1 APN 2 73,118,068 (GRCm39) splice site probably null
IGL02969:Cir1 APN 2 73,134,120 (GRCm39) missense probably null 1.00
IGL03019:Cir1 APN 2 73,116,692 (GRCm39) missense unknown
magellanic UTSW 2 73,136,757 (GRCm39) splice site probably benign
penguin UTSW 2 73,142,823 (GRCm39) missense probably damaging 1.00
R0532:Cir1 UTSW 2 73,140,799 (GRCm39) critical splice donor site probably null
R1052:Cir1 UTSW 2 73,117,987 (GRCm39) missense probably damaging 1.00
R1366:Cir1 UTSW 2 73,136,757 (GRCm39) splice site probably benign
R1752:Cir1 UTSW 2 73,140,882 (GRCm39) missense probably damaging 1.00
R2140:Cir1 UTSW 2 73,142,781 (GRCm39) missense probably damaging 1.00
R4740:Cir1 UTSW 2 73,142,867 (GRCm39) unclassified probably benign
R4954:Cir1 UTSW 2 73,140,848 (GRCm39) missense probably benign 0.40
R5096:Cir1 UTSW 2 73,134,105 (GRCm39) missense probably damaging 1.00
R5134:Cir1 UTSW 2 73,114,847 (GRCm39) nonsense probably null
R5821:Cir1 UTSW 2 73,142,804 (GRCm39) missense probably damaging 1.00
R7183:Cir1 UTSW 2 73,116,730 (GRCm39) missense probably damaging 1.00
R7706:Cir1 UTSW 2 73,142,823 (GRCm39) missense probably damaging 1.00
R7724:Cir1 UTSW 2 73,137,234 (GRCm39) missense possibly damaging 0.85
R7921:Cir1 UTSW 2 73,140,799 (GRCm39) critical splice donor site probably null
R8922:Cir1 UTSW 2 73,118,053 (GRCm39) missense possibly damaging 0.94
R9514:Cir1 UTSW 2 73,142,781 (GRCm39) missense probably damaging 1.00
R9746:Cir1 UTSW 2 73,134,152 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACCATCTCTGAGAGCC -3'
(R):5'- TCATTATAGAAGACAAGTGGGCTGG -3'

Sequencing Primer
(F):5'- TCACGTAGGATTCGCTCCCAG -3'
(R):5'- ACAGGAGTTCCTCTGTGCAAG -3'
Posted On 2019-05-13