Incidental Mutation 'R7006:Wipf1'
ID544705
Institutional Source Beutler Lab
Gene Symbol Wipf1
Ensembl Gene ENSMUSG00000075284
Gene NameWAS/WASL interacting protein family, member 1
SynonymsWIP, D2Ertd120e, Waspip
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7006 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location73429610-73529734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73437097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 319 (D319G)
Ref Sequence ENSEMBL: ENSMUSP00000099741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094681] [ENSMUST00000102679] [ENSMUST00000102680] [ENSMUST00000141264]
Predicted Effect probably damaging
Transcript: ENSMUST00000094681
AA Change: D319G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092268
Gene: ENSMUSG00000075284
AA Change: D319G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102679
AA Change: D319G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099740
Gene: ENSMUSG00000075284
AA Change: D319G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102680
AA Change: D319G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099741
Gene: ENSMUSG00000075284
AA Change: D319G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141264
SMART Domains Protein: ENSMUSP00000119190
Gene: ENSMUSG00000075284

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the organization of the actin cytoskeleton. The encoded protein binds to a region of Wiskott-Aldrich syndrome protein that is frequently mutated in Wiskott-Aldrich syndrome, an X-linked recessive disorder. Impairment of the interaction between these two proteins may contribute to the disease. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have immunological abnormalities, although lymphocyte development appears normal. Mutants show abnormal B and T cell proliferative responses, high serum immunoglobulin levels and impaired immunological synapse formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Wipf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Wipf1 APN 2 73447881 missense unknown
IGL02391:Wipf1 APN 2 73434143 missense probably damaging 1.00
IGL02992:Wipf1 APN 2 73434083 missense probably damaging 1.00
PIT1430001:Wipf1 UTSW 2 73437602 missense probably damaging 1.00
R1553:Wipf1 UTSW 2 73437526 missense possibly damaging 0.96
R1920:Wipf1 UTSW 2 73440155 missense probably benign 0.11
R3154:Wipf1 UTSW 2 73437490 missense possibly damaging 0.86
R3161:Wipf1 UTSW 2 73434949 missense probably damaging 0.99
R3975:Wipf1 UTSW 2 73437169 missense probably benign 0.00
R4996:Wipf1 UTSW 2 73440074 unclassified probably benign
R5218:Wipf1 UTSW 2 73444468 missense probably damaging 1.00
R6916:Wipf1 UTSW 2 73437404 missense probably damaging 1.00
R7259:Wipf1 UTSW 2 73435081 missense probably damaging 0.99
R7486:Wipf1 UTSW 2 73440074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTAGAGAGGTGACATCCCCG -3'
(R):5'- AACCGAGGTGCTGCTTTTG -3'

Sequencing Primer
(F):5'- GCGTTGCCATACCTGATCTG -3'
(R):5'- AAGCCGAGCCTTGGATGAC -3'
Posted On2019-05-13