Incidental Mutation 'R7006:Olfr1306'
ID 544708
Institutional Source Beutler Lab
Gene Symbol Olfr1306
Ensembl Gene ENSMUSG00000096566
Gene Name olfactory receptor 1306
Synonyms GA_x6K02T2Q125-72954873-72953935, MOR245-15
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R7006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111911264-111916271 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 111912256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 225 (V225L)
Ref Sequence ENSEMBL: ENSMUSP00000151142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099607] [ENSMUST00000214844]
AlphaFold A2BFL7
Predicted Effect probably benign
Transcript: ENSMUST00000099607
AA Change: V225L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097202
Gene: ENSMUSG00000096566
AA Change: V225L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 4.7e-43 PFAM
Pfam:7tm_1 41 287 9.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214844
AA Change: V225L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Olfr1306
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1306 APN 2 111912036 missense possibly damaging 0.95
IGL01310:Olfr1306 APN 2 111912307 missense probably benign 0.34
IGL01893:Olfr1306 APN 2 111912244 missense possibly damaging 0.65
IGL02433:Olfr1306 APN 2 111912417 missense probably damaging 1.00
IGL03302:Olfr1306 APN 2 111912822 missense possibly damaging 0.61
R0544:Olfr1306 UTSW 2 111912560 nonsense probably null
R0674:Olfr1306 UTSW 2 111912673 missense probably benign 0.41
R1118:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R1764:Olfr1306 UTSW 2 111912181 missense possibly damaging 0.93
R2915:Olfr1306 UTSW 2 111912719 missense probably damaging 1.00
R3976:Olfr1306 UTSW 2 111912606 missense possibly damaging 0.84
R4855:Olfr1306 UTSW 2 111912099 missense probably benign 0.41
R6475:Olfr1306 UTSW 2 111912859 nonsense probably null
R6513:Olfr1306 UTSW 2 111912883 missense possibly damaging 0.89
R6536:Olfr1306 UTSW 2 111912774 missense possibly damaging 0.94
R6748:Olfr1306 UTSW 2 111912357 missense possibly damaging 0.47
R6843:Olfr1306 UTSW 2 111912915 missense probably damaging 1.00
R7169:Olfr1306 UTSW 2 111912594 missense possibly damaging 0.95
R7230:Olfr1306 UTSW 2 111912561 missense probably damaging 1.00
R7419:Olfr1306 UTSW 2 111912090 missense probably damaging 1.00
R7448:Olfr1306 UTSW 2 111912292 missense probably benign 0.00
R7753:Olfr1306 UTSW 2 111912582 missense probably benign 0.06
R7761:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R8330:Olfr1306 UTSW 2 111912379 missense probably benign 0.00
R8497:Olfr1306 UTSW 2 111912619 missense possibly damaging 0.82
R8942:Olfr1306 UTSW 2 111912862 missense probably benign 0.05
R9603:Olfr1306 UTSW 2 111912783 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CAGAAACGGAGTGATAACTGCATC -3'
(R):5'- TTATGAGCCCGAGGATGTGC -3'

Sequencing Primer
(F):5'- GAGTGATAACTGCATCAAATATGGCC -3'
(R):5'- AGCCCGAGGATGTGCATCTTG -3'
Posted On 2019-05-13