Incidental Mutation 'R7006:Fhad1'
ID544710
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7006 (G1)
Quality Score199.468
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 141918291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably null
Transcript: ENSMUST00000036701
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105779
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105780
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7931:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7936:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7950:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTCCACCAAGTCTGTGTG -3'
(R):5'- AGTATTTAAAGGCCGCCTGTCC -3'

Sequencing Primer
(F):5'- CAAGTCTGTGTGTTCCCCTGG -3'
(R):5'- TCCCTGGGCATTTTGAGC -3'
Posted On2019-05-13