Incidental Mutation 'R7006:Kcp'
ID 544717
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Name kielin/chordin-like protein
Synonyms Crim2, LOC333088, KCP
MMRRC Submission 045011-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7006 (G1)
Quality Score 85.0076
Status Not validated
Chromosome 6
Chromosomal Location 29473161-29507951 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 29499169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 298 (Y298D)
Ref Sequence ENSEMBL: ENSMUSP00000099135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479] [ENSMUST00000161237]
AlphaFold Q3U492
Predicted Effect probably damaging
Transcript: ENSMUST00000078112
AA Change: Y298D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: Y298D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091391
AA Change: Y298D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: Y298D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101614
AA Change: Y298D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: Y298D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159479
SMART Domains Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 1 51 4.56e-1 SMART
VWC 54 110 1.98e-8 SMART
VWC 113 169 1.35e-1 SMART
VWC 172 228 5.77e-10 SMART
VWC 231 286 1.21e-3 SMART
VWC 289 353 6.53e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160181
SMART Domains Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 18 74 1.24e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161237
SMART Domains Protein: ENSMUSP00000124097
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 60 92 N/A INTRINSIC
internal_repeat_1 94 117 8.56e-6 PROSPERO
internal_repeat_1 136 159 8.56e-6 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 A G 4: 144,447,853 (GRCm39) V41A probably benign Het
Adcy2 G A 13: 69,036,139 (GRCm39) T174M probably damaging Het
Ankfy1 T A 11: 72,631,290 (GRCm39) I412N probably benign Het
AW146154 T C 7: 41,130,648 (GRCm39) E156G possibly damaging Het
B4galnt1 T C 10: 127,005,700 (GRCm39) L267P probably benign Het
Bod1l T C 5: 41,989,895 (GRCm39) E276G probably damaging Het
Ccdc187 T C 2: 26,171,102 (GRCm39) T459A probably benign Het
Ccdc196 T A 12: 78,255,702 (GRCm39) *177R probably null Het
Cep72 G A 13: 74,198,427 (GRCm39) Q311* probably null Het
Cir1 T C 2: 73,140,834 (GRCm39) Q45R probably damaging Het
Ciz1 T C 2: 32,261,127 (GRCm39) probably null Het
Crtap G T 9: 114,215,391 (GRCm39) A166E probably damaging Het
Dipk1a A G 5: 108,058,027 (GRCm39) V132A probably benign Het
Dmp1 A G 5: 104,360,188 (GRCm39) D288G probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Fmnl2 C A 2: 52,998,266 (GRCm39) Q544K probably benign Het
Gpsm1 T C 2: 26,212,572 (GRCm39) L72P probably damaging Het
Gys1 G A 7: 45,089,437 (GRCm39) A199T probably damaging Het
Kcnq3 A C 15: 65,892,165 (GRCm39) Y403* probably null Het
Kif5c T C 2: 49,625,526 (GRCm39) S599P probably damaging Het
Krt20 A T 11: 99,328,587 (GRCm39) Y113N probably benign Het
Mcm8 T G 2: 132,665,181 (GRCm39) V191G probably damaging Het
Msr1 T A 8: 40,042,423 (GRCm39) D384V probably damaging Het
Mtpap A C 18: 4,380,873 (GRCm39) S184R possibly damaging Het
Npc1l1 G A 11: 6,167,731 (GRCm39) T1020M probably benign Het
Nphp4 A G 4: 152,573,259 (GRCm39) T66A probably benign Het
Or1o3 T A 17: 37,573,625 (GRCm39) *310L probably null Het
Or4f14 C A 2: 111,742,601 (GRCm39) V225L probably benign Het
Or8h10 G A 2: 86,808,303 (GRCm39) T279I probably damaging Het
Or8k18 T A 2: 86,085,572 (GRCm39) Q155L probably benign Het
Phf11d G T 14: 59,590,823 (GRCm39) T178K probably benign Het
Ppm1d A G 11: 85,227,977 (GRCm39) K298E possibly damaging Het
Rab2b A T 14: 52,503,690 (GRCm39) I144K probably benign Het
Stoml1 A G 9: 58,167,523 (GRCm39) D5G probably damaging Het
Styxl2 T C 1: 165,926,663 (GRCm39) N983S probably benign Het
Tanc1 T C 2: 59,626,188 (GRCm39) V515A probably damaging Het
Tas1r3 A G 4: 155,947,361 (GRCm39) V108A possibly damaging Het
Tifab T C 13: 56,324,059 (GRCm39) Y128C probably benign Het
Tmc6 G T 11: 117,665,083 (GRCm39) R397S probably damaging Het
Tnpo3 C T 6: 29,589,162 (GRCm39) A63T probably damaging Het
Trgc4 T A 13: 19,528,995 (GRCm39) probably benign Het
Usp16 G T 16: 87,268,724 (GRCm39) C284F probably damaging Het
Wipf1 T C 2: 73,267,441 (GRCm39) D319G probably damaging Het
Xpnpep3 T A 15: 81,326,649 (GRCm39) W347R probably damaging Het
Zfp180 G T 7: 23,804,537 (GRCm39) E319* probably null Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29,482,656 (GRCm39) missense probably benign
IGL01344:Kcp APN 6 29,498,950 (GRCm39) splice site probably null
IGL01404:Kcp APN 6 29,496,638 (GRCm39) missense probably damaging 0.99
IGL01735:Kcp APN 6 29,498,878 (GRCm39) missense probably damaging 1.00
IGL01776:Kcp APN 6 29,497,907 (GRCm39) missense probably damaging 1.00
IGL02092:Kcp APN 6 29,489,031 (GRCm39) critical splice donor site probably null
IGL02252:Kcp APN 6 29,504,548 (GRCm39) missense probably damaging 1.00
IGL02690:Kcp APN 6 29,484,998 (GRCm39) unclassified probably benign
IGL02817:Kcp APN 6 29,496,968 (GRCm39) missense probably damaging 0.97
IGL03074:Kcp APN 6 29,496,630 (GRCm39) missense probably damaging 1.00
P0045:Kcp UTSW 6 29,498,347 (GRCm39) missense probably damaging 1.00
R0219:Kcp UTSW 6 29,495,784 (GRCm39) missense probably damaging 1.00
R0355:Kcp UTSW 6 29,496,926 (GRCm39) missense possibly damaging 0.89
R0738:Kcp UTSW 6 29,490,438 (GRCm39) missense probably benign 0.24
R1111:Kcp UTSW 6 29,485,422 (GRCm39) missense probably benign
R1304:Kcp UTSW 6 29,501,291 (GRCm39) unclassified probably benign
R1663:Kcp UTSW 6 29,498,964 (GRCm39) missense possibly damaging 0.68
R1808:Kcp UTSW 6 29,505,654 (GRCm39) missense probably benign 0.05
R1907:Kcp UTSW 6 29,497,834 (GRCm39) unclassified probably benign
R2030:Kcp UTSW 6 29,489,071 (GRCm39) missense probably damaging 1.00
R2099:Kcp UTSW 6 29,496,164 (GRCm39) nonsense probably null
R3411:Kcp UTSW 6 29,482,845 (GRCm39) missense possibly damaging 0.68
R3982:Kcp UTSW 6 29,484,636 (GRCm39) missense probably damaging 1.00
R3983:Kcp UTSW 6 29,484,636 (GRCm39) missense probably damaging 1.00
R4223:Kcp UTSW 6 29,482,257 (GRCm39) missense possibly damaging 0.55
R4377:Kcp UTSW 6 29,493,202 (GRCm39) missense probably damaging 1.00
R4570:Kcp UTSW 6 29,491,847 (GRCm39) nonsense probably null
R4624:Kcp UTSW 6 29,482,813 (GRCm39) missense possibly damaging 0.94
R4694:Kcp UTSW 6 29,493,196 (GRCm39) missense probably benign 0.29
R4750:Kcp UTSW 6 29,484,625 (GRCm39) missense probably benign 0.03
R4968:Kcp UTSW 6 29,497,628 (GRCm39) nonsense probably null
R5053:Kcp UTSW 6 29,496,957 (GRCm39) missense probably benign 0.01
R5067:Kcp UTSW 6 29,492,107 (GRCm39) missense probably benign 0.06
R5253:Kcp UTSW 6 29,498,519 (GRCm39) unclassified probably benign
R5418:Kcp UTSW 6 29,504,283 (GRCm39) nonsense probably null
R6020:Kcp UTSW 6 29,502,863 (GRCm39) missense probably benign 0.03
R6033:Kcp UTSW 6 29,493,193 (GRCm39) missense probably damaging 1.00
R6033:Kcp UTSW 6 29,493,193 (GRCm39) missense probably damaging 1.00
R6088:Kcp UTSW 6 29,502,631 (GRCm39) missense probably benign
R6178:Kcp UTSW 6 29,482,887 (GRCm39) missense possibly damaging 0.68
R6285:Kcp UTSW 6 29,502,364 (GRCm39) missense probably benign 0.21
R6310:Kcp UTSW 6 29,493,257 (GRCm39) missense probably damaging 0.98
R6369:Kcp UTSW 6 29,484,693 (GRCm39) missense probably damaging 1.00
R6860:Kcp UTSW 6 29,505,719 (GRCm39) missense probably benign 0.19
R6949:Kcp UTSW 6 29,484,611 (GRCm39) splice site probably null
R6962:Kcp UTSW 6 29,482,839 (GRCm39) missense probably benign 0.08
R7138:Kcp UTSW 6 29,491,861 (GRCm39) nonsense probably null
R7141:Kcp UTSW 6 29,487,511 (GRCm39) nonsense probably null
R7153:Kcp UTSW 6 29,499,014 (GRCm39) missense probably damaging 1.00
R7162:Kcp UTSW 6 29,497,199 (GRCm39) splice site probably null
R7334:Kcp UTSW 6 29,485,511 (GRCm39) missense probably damaging 1.00
R7565:Kcp UTSW 6 29,499,186 (GRCm39) missense probably damaging 1.00
R7671:Kcp UTSW 6 29,496,516 (GRCm39) missense probably benign 0.02
R7766:Kcp UTSW 6 29,496,846 (GRCm39) missense probably damaging 0.98
R7781:Kcp UTSW 6 29,497,764 (GRCm39) missense probably damaging 1.00
R8702:Kcp UTSW 6 29,482,750 (GRCm39) missense probably damaging 1.00
R9384:Kcp UTSW 6 29,496,618 (GRCm39) critical splice donor site probably null
R9425:Kcp UTSW 6 29,489,151 (GRCm39) missense probably benign
R9553:Kcp UTSW 6 29,485,100 (GRCm39) missense probably null 1.00
R9752:Kcp UTSW 6 29,497,754 (GRCm39) missense probably damaging 1.00
R9755:Kcp UTSW 6 29,492,460 (GRCm39) missense probably damaging 1.00
Z1176:Kcp UTSW 6 29,485,011 (GRCm39) missense probably benign 0.23
Z1177:Kcp UTSW 6 29,485,524 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGCCATACTCACGGTACAGC -3'
(R):5'- CAGAGATCCAGCAGCAACTG -3'

Sequencing Primer
(F):5'- ATACTCACGGTACAGCGGCAG -3'
(R):5'- GCAGCAACTGAATCTGTGTC -3'
Posted On 2019-05-13