Mutagenetix > Incidental Mutation

Incidental Mutation 'R7006:Kcp'

544717

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, KCP, LOC333088

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R7006 (G1)

Quality Score

85.0076

Status

Not validated

Chromosome

Chromosomal Location

29473162-29507952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 29499170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 298 (Y298D)

Ref Sequence

ENSEMBL: ENSMUSP00000099135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479] [ENSMUST00000161237]

AlphaFold

Q3U492

Predicted Effect

probably damaging
Transcript: ENSMUST00000078112
AA Change: Y298D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: Y298D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091391
AA Change: Y298D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: Y298D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000101614
AA Change: Y298D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: Y298D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159479

SMART Domains

Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	1	51	4.56e-1	SMART
VWC	54	110	1.98e-8	SMART
VWC	113	169	1.35e-1	SMART
VWC	172	228	5.77e-10	SMART
VWC	231	286	1.21e-3	SMART
VWC	289	353	6.53e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160181

SMART Domains

Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	18	74	1.24e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161237

SMART Domains

Protein: ENSMUSP00000124097
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
coiled coil region	60	92	N/A	INTRINSIC
internal_repeat_1	94	117	8.56e-6	PROSPERO
internal_repeat_1	136	159	8.56e-6	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy2	G	A	13: 68,888,020	T174M	probably damaging	Het
Ankfy1	T	A	11: 72,740,464	I412N	probably benign	Het
AW146154	T	C	7: 41,481,224	E156G	possibly damaging	Het
B4galnt1	T	C	10: 127,169,831	L267P	probably benign	Het
Bod1l	T	C	5: 41,832,552	E276G	probably damaging	Het
Ccdc187	T	C	2: 26,281,090	T459A	probably benign	Het
Cep72	G	A	13: 74,050,308	Q311*	probably null	Het
Cir1	T	C	2: 73,310,490	Q45R	probably damaging	Het
Ciz1	T	C	2: 32,371,115		probably null	Het
Crtap	G	T	9: 114,386,323	A166E	probably damaging	Het
Dmp1	A	G	5: 104,212,322	D288G	probably benign	Het
Dusp27	T	C	1: 166,099,094	N983S	probably benign	Het
Fam69a	A	G	5: 107,910,161	V132A	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Fmnl2	C	A	2: 53,108,254	Q544K	probably benign	Het
Gm13178	A	G	4: 144,721,283	V41A	probably benign	Het
Gm6657	T	A	12: 78,208,928	*177R	probably null	Het
Gpsm1	T	C	2: 26,322,560	L72P	probably damaging	Het
Gys1	G	A	7: 45,440,013	A199T	probably damaging	Het
Kcnq3	A	C	15: 66,020,316	Y403*	probably null	Het
Kif5c	T	C	2: 49,735,514	S599P	probably damaging	Het
Krt20	A	T	11: 99,437,761	Y113N	probably benign	Het
Mcm8	T	G	2: 132,823,261	V191G	probably damaging	Het
Msr1	T	A	8: 39,589,382	D384V	probably damaging	Het
Mtpap	A	C	18: 4,380,873	S184R	possibly damaging	Het
Npc1l1	G	A	11: 6,217,731	T1020M	probably benign	Het
Nphp4	A	G	4: 152,488,802	T66A	probably benign	Het
Olfr1049	T	A	2: 86,255,228	Q155L	probably benign	Het
Olfr1100	G	A	2: 86,977,959	T279I	probably damaging	Het
Olfr1306	C	A	2: 111,912,256	V225L	probably benign	Het
Olfr98	T	A	17: 37,262,734	*310L	probably null	Het
Phf11d	G	T	14: 59,353,374	T178K	probably benign	Het
Ppm1d	A	G	11: 85,337,151	K298E	possibly damaging	Het
Rab2b	A	T	14: 52,266,233	I144K	probably benign	Het
Stoml1	A	G	9: 58,260,240	D5G	probably damaging	Het
Tanc1	T	C	2: 59,795,844	V515A	probably damaging	Het
Tas1r3	A	G	4: 155,862,904	V108A	possibly damaging	Het
Tcrg-C4	T	A	13: 19,344,825		probably benign	Het
Tifab	T	C	13: 56,176,246	Y128C	probably benign	Het
Tmc6	G	T	11: 117,774,257	R397S	probably damaging	Het
Tnpo3	C	T	6: 29,589,163	A63T	probably damaging	Het
Usp16	G	T	16: 87,471,836	C284F	probably damaging	Het
Wipf1	T	C	2: 73,437,097	D319G	probably damaging	Het
Xpnpep3	T	A	15: 81,442,448	W347R	probably damaging	Het
Zfp180	G	T	7: 24,105,112	E319*	probably null	Het

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29482657	missense	probably benign
IGL01344:Kcp	APN	6	29498951	splice site	probably null
IGL01404:Kcp	APN	6	29496639	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29498879	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29497908	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29489032	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29504549	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29484999	unclassified	probably benign
IGL02817:Kcp	APN	6	29496969	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29496631	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29498348	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29495785	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29496927	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29490439	missense	probably benign	0.24
R1111:Kcp	UTSW	6	29485423	missense	probably benign
R1304:Kcp	UTSW	6	29501292	unclassified	probably benign
R1663:Kcp	UTSW	6	29498965	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29505655	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29497835	unclassified	probably benign
R2030:Kcp	UTSW	6	29489072	missense	probably damaging	1.00
R2099:Kcp	UTSW	6	29496165	nonsense	probably null
R3411:Kcp	UTSW	6	29482846	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29482258	missense	possibly damaging	0.55
R4377:Kcp	UTSW	6	29493203	missense	probably damaging	1.00
R4570:Kcp	UTSW	6	29491848	nonsense	probably null
R4624:Kcp	UTSW	6	29482814	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29493197	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29484626	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29497629	nonsense	probably null
R5053:Kcp	UTSW	6	29496958	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29492108	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29498520	unclassified	probably benign
R5418:Kcp	UTSW	6	29504284	nonsense	probably null
R6020:Kcp	UTSW	6	29502864	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29502632	missense	probably benign
R6178:Kcp	UTSW	6	29482888	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29502365	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29493258	missense	probably damaging	0.98
R6369:Kcp	UTSW	6	29484694	missense	probably damaging	1.00
R6860:Kcp	UTSW	6	29505720	missense	probably benign	0.19
R6949:Kcp	UTSW	6	29484612	splice site	probably null
R6962:Kcp	UTSW	6	29482840	missense	probably benign	0.08
R7138:Kcp	UTSW	6	29491862	nonsense	probably null
R7141:Kcp	UTSW	6	29487512	nonsense	probably null
R7153:Kcp	UTSW	6	29499015	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29497200	splice site	probably null
R7334:Kcp	UTSW	6	29485512	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29499187	missense	probably damaging	1.00
R7671:Kcp	UTSW	6	29496517	missense	probably benign	0.02
R7766:Kcp	UTSW	6	29496847	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29497765	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29482751	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29496619	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29489152	missense	probably benign
R9553:Kcp	UTSW	6	29485101	missense	probably null	1.00
R9752:Kcp	UTSW	6	29497755	missense	probably damaging	1.00
R9755:Kcp	UTSW	6	29492461	missense	probably damaging	1.00
Z1176:Kcp	UTSW	6	29485012	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29485525	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- AGCCATACTCACGGTACAGC -3'
(R):5'- CAGAGATCCAGCAGCAACTG -3'

Sequencing Primer
(F):5'- ATACTCACGGTACAGCGGCAG -3'
(R):5'- GCAGCAACTGAATCTGTGTC -3'

Posted On

2019-05-13