Incidental Mutation 'R7006:Tnpo3'
ID 544718
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Name transportin 3
Synonyms D6Ertd313e, 5730544L10Rik, C430013M08Rik
MMRRC Submission 045011-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 29540826-29609886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 29589162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 63 (A63T)
Ref Sequence ENSEMBL: ENSMUSP00000110906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]
AlphaFold Q6P2B1
Predicted Effect probably damaging
Transcript: ENSMUST00000012679
AA Change: A63T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: A63T

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115251
AA Change: A63T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: A63T

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 A G 4: 144,447,853 (GRCm39) V41A probably benign Het
Adcy2 G A 13: 69,036,139 (GRCm39) T174M probably damaging Het
Ankfy1 T A 11: 72,631,290 (GRCm39) I412N probably benign Het
AW146154 T C 7: 41,130,648 (GRCm39) E156G possibly damaging Het
B4galnt1 T C 10: 127,005,700 (GRCm39) L267P probably benign Het
Bod1l T C 5: 41,989,895 (GRCm39) E276G probably damaging Het
Ccdc187 T C 2: 26,171,102 (GRCm39) T459A probably benign Het
Ccdc196 T A 12: 78,255,702 (GRCm39) *177R probably null Het
Cep72 G A 13: 74,198,427 (GRCm39) Q311* probably null Het
Cir1 T C 2: 73,140,834 (GRCm39) Q45R probably damaging Het
Ciz1 T C 2: 32,261,127 (GRCm39) probably null Het
Crtap G T 9: 114,215,391 (GRCm39) A166E probably damaging Het
Dipk1a A G 5: 108,058,027 (GRCm39) V132A probably benign Het
Dmp1 A G 5: 104,360,188 (GRCm39) D288G probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Fmnl2 C A 2: 52,998,266 (GRCm39) Q544K probably benign Het
Gpsm1 T C 2: 26,212,572 (GRCm39) L72P probably damaging Het
Gys1 G A 7: 45,089,437 (GRCm39) A199T probably damaging Het
Kcnq3 A C 15: 65,892,165 (GRCm39) Y403* probably null Het
Kcp A C 6: 29,499,169 (GRCm39) Y298D probably damaging Het
Kif5c T C 2: 49,625,526 (GRCm39) S599P probably damaging Het
Krt20 A T 11: 99,328,587 (GRCm39) Y113N probably benign Het
Mcm8 T G 2: 132,665,181 (GRCm39) V191G probably damaging Het
Msr1 T A 8: 40,042,423 (GRCm39) D384V probably damaging Het
Mtpap A C 18: 4,380,873 (GRCm39) S184R possibly damaging Het
Npc1l1 G A 11: 6,167,731 (GRCm39) T1020M probably benign Het
Nphp4 A G 4: 152,573,259 (GRCm39) T66A probably benign Het
Or1o3 T A 17: 37,573,625 (GRCm39) *310L probably null Het
Or4f14 C A 2: 111,742,601 (GRCm39) V225L probably benign Het
Or8h10 G A 2: 86,808,303 (GRCm39) T279I probably damaging Het
Or8k18 T A 2: 86,085,572 (GRCm39) Q155L probably benign Het
Phf11d G T 14: 59,590,823 (GRCm39) T178K probably benign Het
Ppm1d A G 11: 85,227,977 (GRCm39) K298E possibly damaging Het
Rab2b A T 14: 52,503,690 (GRCm39) I144K probably benign Het
Stoml1 A G 9: 58,167,523 (GRCm39) D5G probably damaging Het
Styxl2 T C 1: 165,926,663 (GRCm39) N983S probably benign Het
Tanc1 T C 2: 59,626,188 (GRCm39) V515A probably damaging Het
Tas1r3 A G 4: 155,947,361 (GRCm39) V108A possibly damaging Het
Tifab T C 13: 56,324,059 (GRCm39) Y128C probably benign Het
Tmc6 G T 11: 117,665,083 (GRCm39) R397S probably damaging Het
Trgc4 T A 13: 19,528,995 (GRCm39) probably benign Het
Usp16 G T 16: 87,268,724 (GRCm39) C284F probably damaging Het
Wipf1 T C 2: 73,267,441 (GRCm39) D319G probably damaging Het
Xpnpep3 T A 15: 81,326,649 (GRCm39) W347R probably damaging Het
Zfp180 G T 7: 23,804,537 (GRCm39) E319* probably null Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29,578,460 (GRCm39) critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29,565,845 (GRCm39) nonsense probably null
IGL00753:Tnpo3 APN 6 29,565,786 (GRCm39) missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29,589,047 (GRCm39) missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29,586,077 (GRCm39) missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29,575,019 (GRCm39) missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29,589,019 (GRCm39) splice site probably benign
IGL01987:Tnpo3 APN 6 29,560,200 (GRCm39) missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29,609,450 (GRCm39) missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29,562,899 (GRCm39) nonsense probably null
IGL03409:Tnpo3 APN 6 29,555,181 (GRCm39) missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29,555,221 (GRCm39) missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29,589,176 (GRCm39) missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29,589,176 (GRCm39) missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29,568,921 (GRCm39) missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29,565,651 (GRCm39) splice site probably benign
R0384:Tnpo3 UTSW 6 29,582,163 (GRCm39) critical splice donor site probably null
R0597:Tnpo3 UTSW 6 29,578,564 (GRCm39) nonsense probably null
R0710:Tnpo3 UTSW 6 29,586,074 (GRCm39) missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29,554,992 (GRCm39) splice site probably benign
R1494:Tnpo3 UTSW 6 29,557,043 (GRCm39) missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29,560,220 (GRCm39) missense possibly damaging 0.70
R1663:Tnpo3 UTSW 6 29,565,758 (GRCm39) missense probably benign 0.04
R1816:Tnpo3 UTSW 6 29,557,016 (GRCm39) missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29,586,143 (GRCm39) missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29,551,871 (GRCm39) missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29,589,035 (GRCm39) missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29,579,618 (GRCm39) missense probably benign 0.19
R3765:Tnpo3 UTSW 6 29,579,688 (GRCm39) missense probably benign 0.00
R3766:Tnpo3 UTSW 6 29,579,688 (GRCm39) missense probably benign 0.00
R4125:Tnpo3 UTSW 6 29,560,091 (GRCm39) missense probably damaging 1.00
R4525:Tnpo3 UTSW 6 29,561,397 (GRCm39) missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29,578,541 (GRCm39) missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29,568,937 (GRCm39) missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29,582,259 (GRCm39) missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29,582,152 (GRCm39) splice site probably benign
R5325:Tnpo3 UTSW 6 29,602,012 (GRCm39) intron probably benign
R5512:Tnpo3 UTSW 6 29,575,045 (GRCm39) missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29,565,197 (GRCm39) nonsense probably null
R5689:Tnpo3 UTSW 6 29,571,063 (GRCm39) missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29,589,032 (GRCm39) missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29,588,042 (GRCm39) nonsense probably null
R6105:Tnpo3 UTSW 6 29,588,042 (GRCm39) nonsense probably null
R6137:Tnpo3 UTSW 6 29,555,267 (GRCm39) missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29,571,100 (GRCm39) missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29,572,702 (GRCm39) splice site probably null
R6569:Tnpo3 UTSW 6 29,571,065 (GRCm39) missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29,572,594 (GRCm39) nonsense probably null
R7312:Tnpo3 UTSW 6 29,562,875 (GRCm39) missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29,556,995 (GRCm39) missense probably damaging 1.00
R7686:Tnpo3 UTSW 6 29,562,899 (GRCm39) nonsense probably null
R7898:Tnpo3 UTSW 6 29,565,223 (GRCm39) missense probably benign 0.01
R7901:Tnpo3 UTSW 6 29,568,990 (GRCm39) missense possibly damaging 0.83
R8003:Tnpo3 UTSW 6 29,551,900 (GRCm39) missense probably benign 0.09
R8144:Tnpo3 UTSW 6 29,558,761 (GRCm39) missense probably benign
R8147:Tnpo3 UTSW 6 29,589,213 (GRCm39) missense probably benign 0.01
R8183:Tnpo3 UTSW 6 29,558,758 (GRCm39) missense probably damaging 0.97
R8297:Tnpo3 UTSW 6 29,582,302 (GRCm39) missense possibly damaging 0.91
R8329:Tnpo3 UTSW 6 29,558,832 (GRCm39) nonsense probably null
R8424:Tnpo3 UTSW 6 29,555,205 (GRCm39) missense probably benign 0.06
R8798:Tnpo3 UTSW 6 29,572,620 (GRCm39) missense probably benign
R8841:Tnpo3 UTSW 6 29,589,182 (GRCm39) missense probably damaging 1.00
R9345:Tnpo3 UTSW 6 29,558,851 (GRCm39) missense probably benign
R9652:Tnpo3 UTSW 6 29,560,173 (GRCm39) nonsense probably null
R9699:Tnpo3 UTSW 6 29,565,768 (GRCm39) missense probably benign 0.11
Z1088:Tnpo3 UTSW 6 29,565,842 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCCAAATGACCTTACAAATGTCCG -3'
(R):5'- GTTGAACATTGAACAGACCCTAC -3'

Sequencing Primer
(F):5'- GTCCGTAATGAGTACAGGCTTTACC -3'
(R):5'- CATTGAACAGACCCTACATACAAAC -3'
Posted On 2019-05-13