Incidental Mutation 'R7006:AW146154'
ID 544720
Institutional Source Beutler Lab
Gene Symbol AW146154
Ensembl Gene ENSMUSG00000074166
Gene Name expressed sequence AW146154
Synonyms
MMRRC Submission 045011-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 41128298-41149314 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41130648 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 156 (E156G)
Ref Sequence ENSEMBL: ENSMUSP00000096109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000098509]
AlphaFold Q3TPQ7
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect possibly damaging
Transcript: ENSMUST00000098509
AA Change: E156G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096109
Gene: ENSMUSG00000074166
AA Change: E156G

DomainStartEndE-ValueType
KRAB 4 66 9.86e-14 SMART
ZnF_C2H2 75 97 9.08e1 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 4.72e-2 SMART
ZnF_C2H2 187 209 3.63e-3 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 4.24e-4 SMART
ZnF_C2H2 271 293 5.81e-2 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 2.12e-4 SMART
ZnF_C2H2 355 377 1.6e-4 SMART
ZnF_C2H2 383 405 8.47e-4 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 1.6e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 A G 4: 144,447,853 (GRCm39) V41A probably benign Het
Adcy2 G A 13: 69,036,139 (GRCm39) T174M probably damaging Het
Ankfy1 T A 11: 72,631,290 (GRCm39) I412N probably benign Het
B4galnt1 T C 10: 127,005,700 (GRCm39) L267P probably benign Het
Bod1l T C 5: 41,989,895 (GRCm39) E276G probably damaging Het
Ccdc187 T C 2: 26,171,102 (GRCm39) T459A probably benign Het
Ccdc196 T A 12: 78,255,702 (GRCm39) *177R probably null Het
Cep72 G A 13: 74,198,427 (GRCm39) Q311* probably null Het
Cir1 T C 2: 73,140,834 (GRCm39) Q45R probably damaging Het
Ciz1 T C 2: 32,261,127 (GRCm39) probably null Het
Crtap G T 9: 114,215,391 (GRCm39) A166E probably damaging Het
Dipk1a A G 5: 108,058,027 (GRCm39) V132A probably benign Het
Dmp1 A G 5: 104,360,188 (GRCm39) D288G probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Fmnl2 C A 2: 52,998,266 (GRCm39) Q544K probably benign Het
Gpsm1 T C 2: 26,212,572 (GRCm39) L72P probably damaging Het
Gys1 G A 7: 45,089,437 (GRCm39) A199T probably damaging Het
Kcnq3 A C 15: 65,892,165 (GRCm39) Y403* probably null Het
Kcp A C 6: 29,499,169 (GRCm39) Y298D probably damaging Het
Kif5c T C 2: 49,625,526 (GRCm39) S599P probably damaging Het
Krt20 A T 11: 99,328,587 (GRCm39) Y113N probably benign Het
Mcm8 T G 2: 132,665,181 (GRCm39) V191G probably damaging Het
Msr1 T A 8: 40,042,423 (GRCm39) D384V probably damaging Het
Mtpap A C 18: 4,380,873 (GRCm39) S184R possibly damaging Het
Npc1l1 G A 11: 6,167,731 (GRCm39) T1020M probably benign Het
Nphp4 A G 4: 152,573,259 (GRCm39) T66A probably benign Het
Or1o3 T A 17: 37,573,625 (GRCm39) *310L probably null Het
Or4f14 C A 2: 111,742,601 (GRCm39) V225L probably benign Het
Or8h10 G A 2: 86,808,303 (GRCm39) T279I probably damaging Het
Or8k18 T A 2: 86,085,572 (GRCm39) Q155L probably benign Het
Phf11d G T 14: 59,590,823 (GRCm39) T178K probably benign Het
Ppm1d A G 11: 85,227,977 (GRCm39) K298E possibly damaging Het
Rab2b A T 14: 52,503,690 (GRCm39) I144K probably benign Het
Stoml1 A G 9: 58,167,523 (GRCm39) D5G probably damaging Het
Styxl2 T C 1: 165,926,663 (GRCm39) N983S probably benign Het
Tanc1 T C 2: 59,626,188 (GRCm39) V515A probably damaging Het
Tas1r3 A G 4: 155,947,361 (GRCm39) V108A possibly damaging Het
Tifab T C 13: 56,324,059 (GRCm39) Y128C probably benign Het
Tmc6 G T 11: 117,665,083 (GRCm39) R397S probably damaging Het
Tnpo3 C T 6: 29,589,162 (GRCm39) A63T probably damaging Het
Trgc4 T A 13: 19,528,995 (GRCm39) probably benign Het
Usp16 G T 16: 87,268,724 (GRCm39) C284F probably damaging Het
Wipf1 T C 2: 73,267,441 (GRCm39) D319G probably damaging Het
Xpnpep3 T A 15: 81,326,649 (GRCm39) W347R probably damaging Het
Zfp180 G T 7: 23,804,537 (GRCm39) E319* probably null Het
Other mutations in AW146154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:AW146154 APN 7 41,129,883 (GRCm39) missense probably damaging 1.00
R1351:AW146154 UTSW 7 41,129,878 (GRCm39) missense probably damaging 1.00
R3763:AW146154 UTSW 7 41,129,794 (GRCm39) missense probably damaging 1.00
R4829:AW146154 UTSW 7 41,130,057 (GRCm39) missense possibly damaging 0.62
R4835:AW146154 UTSW 7 41,129,892 (GRCm39) missense probably damaging 1.00
R5326:AW146154 UTSW 7 41,130,801 (GRCm39) missense probably benign 0.00
R5542:AW146154 UTSW 7 41,130,801 (GRCm39) missense probably benign 0.00
R5976:AW146154 UTSW 7 41,129,721 (GRCm39) missense probably damaging 0.99
R6252:AW146154 UTSW 7 41,130,811 (GRCm39) missense probably benign 0.10
R7053:AW146154 UTSW 7 41,131,988 (GRCm39) critical splice donor site probably null
R7096:AW146154 UTSW 7 41,130,867 (GRCm39) missense probably benign 0.32
R7649:AW146154 UTSW 7 41,130,156 (GRCm39) missense probably benign 0.13
R8069:AW146154 UTSW 7 41,129,935 (GRCm39) missense probably benign 0.01
R8085:AW146154 UTSW 7 41,130,622 (GRCm39) missense probably damaging 1.00
R8085:AW146154 UTSW 7 41,130,621 (GRCm39) missense possibly damaging 0.61
R8266:AW146154 UTSW 7 41,130,592 (GRCm39) nonsense probably null
R8698:AW146154 UTSW 7 41,129,934 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTCATAGGGTTTCTCTCCAG -3'
(R):5'- TGGAAACAAAATGTGGAAACCTT -3'

Sequencing Primer
(F):5'- CCAGTATGTGTTCTTTCATGTAATCG -3'
(R):5'- GACATCATCGCATTCATACTGGAGAG -3'
Posted On 2019-05-13