Incidental Mutation 'R7006:Gys1'
ID 544721
Institutional Source Beutler Lab
Gene Symbol Gys1
Ensembl Gene ENSMUSG00000003865
Gene Name glycogen synthase 1, muscle
Synonyms MGS, Gys3
MMRRC Submission 045011-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45084268-45106043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45089437 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000148252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003964] [ENSMUST00000211150] [ENSMUST00000211214]
AlphaFold Q9Z1E4
Predicted Effect probably damaging
Transcript: ENSMUST00000003964
AA Change: A263T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003964
Gene: ENSMUSG00000003865
AA Change: A263T

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glyco_transf_5 28 274 5.2e-8 PFAM
Pfam:Glycogen_syn 31 663 N/A PFAM
low complexity region 670 686 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
low complexity region 716 733 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211150
AA Change: A199T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000211214
Meta Mutation Damage Score 0.4350 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the addition of glucose monomers to the growing glycogen molecule through the formation of alpha-1,4-glycoside linkages. Mutations in this gene are associated with muscle glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display neonatal lethality due to impaired cardiac function and exhibit reduced reduced ventricular chamber size, dilated atria, vascular congestion, and liver hemorrhage. Mice homozygous for a knock-in allele show altered glycogen homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 A G 4: 144,447,853 (GRCm39) V41A probably benign Het
Adcy2 G A 13: 69,036,139 (GRCm39) T174M probably damaging Het
Ankfy1 T A 11: 72,631,290 (GRCm39) I412N probably benign Het
AW146154 T C 7: 41,130,648 (GRCm39) E156G possibly damaging Het
B4galnt1 T C 10: 127,005,700 (GRCm39) L267P probably benign Het
Bod1l T C 5: 41,989,895 (GRCm39) E276G probably damaging Het
Ccdc187 T C 2: 26,171,102 (GRCm39) T459A probably benign Het
Ccdc196 T A 12: 78,255,702 (GRCm39) *177R probably null Het
Cep72 G A 13: 74,198,427 (GRCm39) Q311* probably null Het
Cir1 T C 2: 73,140,834 (GRCm39) Q45R probably damaging Het
Ciz1 T C 2: 32,261,127 (GRCm39) probably null Het
Crtap G T 9: 114,215,391 (GRCm39) A166E probably damaging Het
Dipk1a A G 5: 108,058,027 (GRCm39) V132A probably benign Het
Dmp1 A G 5: 104,360,188 (GRCm39) D288G probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Fmnl2 C A 2: 52,998,266 (GRCm39) Q544K probably benign Het
Gpsm1 T C 2: 26,212,572 (GRCm39) L72P probably damaging Het
Kcnq3 A C 15: 65,892,165 (GRCm39) Y403* probably null Het
Kcp A C 6: 29,499,169 (GRCm39) Y298D probably damaging Het
Kif5c T C 2: 49,625,526 (GRCm39) S599P probably damaging Het
Krt20 A T 11: 99,328,587 (GRCm39) Y113N probably benign Het
Mcm8 T G 2: 132,665,181 (GRCm39) V191G probably damaging Het
Msr1 T A 8: 40,042,423 (GRCm39) D384V probably damaging Het
Mtpap A C 18: 4,380,873 (GRCm39) S184R possibly damaging Het
Npc1l1 G A 11: 6,167,731 (GRCm39) T1020M probably benign Het
Nphp4 A G 4: 152,573,259 (GRCm39) T66A probably benign Het
Or1o3 T A 17: 37,573,625 (GRCm39) *310L probably null Het
Or4f14 C A 2: 111,742,601 (GRCm39) V225L probably benign Het
Or8h10 G A 2: 86,808,303 (GRCm39) T279I probably damaging Het
Or8k18 T A 2: 86,085,572 (GRCm39) Q155L probably benign Het
Phf11d G T 14: 59,590,823 (GRCm39) T178K probably benign Het
Ppm1d A G 11: 85,227,977 (GRCm39) K298E possibly damaging Het
Rab2b A T 14: 52,503,690 (GRCm39) I144K probably benign Het
Stoml1 A G 9: 58,167,523 (GRCm39) D5G probably damaging Het
Styxl2 T C 1: 165,926,663 (GRCm39) N983S probably benign Het
Tanc1 T C 2: 59,626,188 (GRCm39) V515A probably damaging Het
Tas1r3 A G 4: 155,947,361 (GRCm39) V108A possibly damaging Het
Tifab T C 13: 56,324,059 (GRCm39) Y128C probably benign Het
Tmc6 G T 11: 117,665,083 (GRCm39) R397S probably damaging Het
Tnpo3 C T 6: 29,589,162 (GRCm39) A63T probably damaging Het
Trgc4 T A 13: 19,528,995 (GRCm39) probably benign Het
Usp16 G T 16: 87,268,724 (GRCm39) C284F probably damaging Het
Wipf1 T C 2: 73,267,441 (GRCm39) D319G probably damaging Het
Xpnpep3 T A 15: 81,326,649 (GRCm39) W347R probably damaging Het
Zfp180 G T 7: 23,804,537 (GRCm39) E319* probably null Het
Other mutations in Gys1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gys1 APN 7 45,094,256 (GRCm39) missense possibly damaging 0.88
IGL00870:Gys1 APN 7 45,097,437 (GRCm39) critical splice donor site probably null
IGL01346:Gys1 APN 7 45,091,961 (GRCm39) missense probably damaging 1.00
IGL02396:Gys1 APN 7 45,089,012 (GRCm39) missense probably damaging 1.00
IGL03157:Gys1 APN 7 45,089,323 (GRCm39) unclassified probably benign
IGL03196:Gys1 APN 7 45,104,241 (GRCm39) splice site probably benign
R0095:Gys1 UTSW 7 45,094,073 (GRCm39) missense possibly damaging 0.87
R0284:Gys1 UTSW 7 45,086,143 (GRCm39) unclassified probably benign
R0537:Gys1 UTSW 7 45,089,425 (GRCm39) missense probably damaging 1.00
R0622:Gys1 UTSW 7 45,089,419 (GRCm39) missense probably damaging 1.00
R1749:Gys1 UTSW 7 45,089,456 (GRCm39) missense probably damaging 1.00
R1968:Gys1 UTSW 7 45,092,970 (GRCm39) missense probably damaging 1.00
R3953:Gys1 UTSW 7 45,089,470 (GRCm39) missense probably damaging 1.00
R4058:Gys1 UTSW 7 45,097,810 (GRCm39) splice site probably benign
R4626:Gys1 UTSW 7 45,088,958 (GRCm39) missense probably damaging 1.00
R4661:Gys1 UTSW 7 45,104,258 (GRCm39) missense probably damaging 1.00
R4998:Gys1 UTSW 7 45,100,968 (GRCm39) intron probably benign
R5965:Gys1 UTSW 7 45,104,763 (GRCm39) missense probably benign 0.25
R5987:Gys1 UTSW 7 45,087,529 (GRCm39) missense probably benign 0.00
R6059:Gys1 UTSW 7 45,104,712 (GRCm39) splice site probably null
R6481:Gys1 UTSW 7 45,092,393 (GRCm39) missense possibly damaging 0.63
R6788:Gys1 UTSW 7 45,094,102 (GRCm39) missense probably damaging 0.99
R6924:Gys1 UTSW 7 45,093,059 (GRCm39) critical splice donor site probably null
R7029:Gys1 UTSW 7 45,089,008 (GRCm39) missense possibly damaging 0.93
R7060:Gys1 UTSW 7 45,089,437 (GRCm39) missense probably damaging 1.00
R7211:Gys1 UTSW 7 45,097,684 (GRCm39) missense possibly damaging 0.88
R7237:Gys1 UTSW 7 45,104,586 (GRCm39) missense probably benign 0.02
R7242:Gys1 UTSW 7 45,089,092 (GRCm39) splice site probably null
R7593:Gys1 UTSW 7 45,092,360 (GRCm39) missense probably damaging 0.99
R7641:Gys1 UTSW 7 45,104,495 (GRCm39) missense probably damaging 0.98
R7674:Gys1 UTSW 7 45,104,495 (GRCm39) missense probably damaging 0.98
R7756:Gys1 UTSW 7 45,097,726 (GRCm39) missense probably benign 0.43
R8197:Gys1 UTSW 7 45,092,348 (GRCm39) missense possibly damaging 0.80
R9082:Gys1 UTSW 7 45,088,917 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCGTGCTCCTAAGAGTGCAG -3'
(R):5'- AGCCAGCTTCATTTACGAGTTAC -3'

Sequencing Primer
(F):5'- TAAGAGTGCAGGCTCCCAG -3'
(R):5'- GTTACCATCTCAATCCAGGACTTAGG -3'
Posted On 2019-05-13