Incidental Mutation 'R7006:Crtap'
ID544724
Institutional Source Beutler Lab
Gene Symbol Crtap
Ensembl Gene ENSMUSG00000032431
Gene Namecartilage associated protein
Synonyms5730529N23Rik, P3h5, CASP, Leprel3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7006 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location114375134-114390675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114386323 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 166 (A166E)
Ref Sequence ENSEMBL: ENSMUSP00000081941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084881]
Predicted Effect probably damaging
Transcript: ENSMUST00000084881
AA Change: A166E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081941
Gene: ENSMUSG00000032431
AA Change: A166E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
internal_repeat_1 39 188 1.53e-14 PROSPERO
internal_repeat_1 201 338 1.53e-14 PROSPERO
low complexity region 380 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the chicken and mouse CRTAP genes. The encoded protein is a scaffolding protein that may influence the activity of at least one member of the cytohesin/ARNO family in response to specific cellular stimuli. Defects in this gene are associated with osteogenesis imperfecta, a connective tissue disorder characterized by bone fragility and low bone mass. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes develop kyphoscoliosis and osteoporosis as a result of defects in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Crtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02721:Crtap APN 9 114381639 missense probably damaging 0.99
IGL03131:Crtap APN 9 114380004 missense possibly damaging 0.88
IGL03155:Crtap APN 9 114380049 missense possibly damaging 0.68
R2014:Crtap UTSW 9 114381585 critical splice donor site probably null
R2143:Crtap UTSW 9 114379968 missense probably damaging 1.00
R4572:Crtap UTSW 9 114384806 missense probably benign 0.41
R4781:Crtap UTSW 9 114386236 missense probably benign 0.01
R5055:Crtap UTSW 9 114390140 missense probably benign 0.36
R5157:Crtap UTSW 9 114384792 missense probably damaging 1.00
R5733:Crtap UTSW 9 114378096 missense probably benign 0.07
R6858:Crtap UTSW 9 114380016 missense probably damaging 1.00
R6906:Crtap UTSW 9 114381632 missense probably benign 0.42
R7156:Crtap UTSW 9 114378096 missense probably benign 0.07
R7705:Crtap UTSW 9 114381679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGTTGCTCCCAGAGTCCC -3'
(R):5'- TGCTCTCGTAACTGGAAATGTCATC -3'

Sequencing Primer
(F):5'- CACACCAACTTCGGGGTAAAG -3'
(R):5'- ATGAGACTGGCTCTATTCACGCATG -3'
Posted On2019-05-13