Mutagenetix > Incidental Mutation

Incidental Mutation 'R7006:Ankfy1'

544727

Institutional Source

Beutler Lab

Gene Symbol

Ankfy1

Ensembl Gene

ENSMUSG00000020790

Gene Name

ankyrin repeat and FYVE domain containing 1

Synonyms

Ankhzn

MMRRC Submission

Accession Numbers

Genbank: NM_009671.5

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7006 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72690006-72772146 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72740464 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 412 (I412N)

Ref Sequence

ENSEMBL: ENSMUSP00000118751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]

AlphaFold

Q810B6

Predicted Effect

unknown
Transcript: ENSMUST00000127610
AA Change: H428Q

SMART Domains

Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790
AA Change: H428Q

Domain	Start	End	E-Value	Type
Blast:UBCc	4	33	3e-8	BLAST
BTB	68	162	3.26e-20	SMART
Blast:ANK	217	247	6e-8	BLAST
ANK	255	284	5.29e0	SMART
ANK	288	317	1.04e2	SMART
ANK	322	362	4.3e0	SMART
ANK	366	395	4.73e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155998
AA Change: I412N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: I412N

Domain	Start	End	E-Value	Type
coiled coil region	1	45	N/A	INTRINSIC
BTB	68	162	3.26e-20	SMART
ANK	255	284	5.29e0	SMART
ANK	288	317	1.04e2	SMART
ANK	322	362	4.3e0	SMART
ANK	366	396	9.75e1	SMART
ANK	400	452	8.5e2	SMART
low complexity region	465	478	N/A	INTRINSIC
ANK	490	519	4.56e-4	SMART
ANK	542	572	3.18e-3	SMART
ANK	588	617	1.72e1	SMART
ANK	621	650	5.16e-3	SMART
ANK	654	683	8.14e-1	SMART
ANK	687	716	5.37e-1	SMART
ANK	724	753	3.08e-1	SMART
ANK	769	798	2.56e-7	SMART
ANK	802	830	1.93e-2	SMART
ANK	836	865	3.47e2	SMART
ANK	870	899	9.49e-2	SMART
ANK	905	934	2.41e-3	SMART
ANK	938	967	1.34e-1	SMART
ANK	971	1001	4.43e-2	SMART
Blast:ANK	1005	1039	2e-16	BLAST
ANK	1043	1074	5.67e0	SMART
FYVE	1099	1165	3.98e-28	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy2	G	A	13: 68,888,020	T174M	probably damaging	Het
AW146154	T	C	7: 41,481,224	E156G	possibly damaging	Het
B4galnt1	T	C	10: 127,169,831	L267P	probably benign	Het
Bod1l	T	C	5: 41,832,552	E276G	probably damaging	Het
Ccdc187	T	C	2: 26,281,090	T459A	probably benign	Het
Cep72	G	A	13: 74,050,308	Q311*	probably null	Het
Cir1	T	C	2: 73,310,490	Q45R	probably damaging	Het
Ciz1	T	C	2: 32,371,115		probably null	Het
Crtap	G	T	9: 114,386,323	A166E	probably damaging	Het
Dmp1	A	G	5: 104,212,322	D288G	probably benign	Het
Dusp27	T	C	1: 166,099,094	N983S	probably benign	Het
Fam69a	A	G	5: 107,910,161	V132A	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Fmnl2	C	A	2: 53,108,254	Q544K	probably benign	Het
Gm13178	A	G	4: 144,721,283	V41A	probably benign	Het
Gm6657	T	A	12: 78,208,928	*177R	probably null	Het
Gpsm1	T	C	2: 26,322,560	L72P	probably damaging	Het
Gys1	G	A	7: 45,440,013	A199T	probably damaging	Het
Kcnq3	A	C	15: 66,020,316	Y403*	probably null	Het
Kcp	A	C	6: 29,499,170	Y298D	probably damaging	Het
Kif5c	T	C	2: 49,735,514	S599P	probably damaging	Het
Krt20	A	T	11: 99,437,761	Y113N	probably benign	Het
Mcm8	T	G	2: 132,823,261	V191G	probably damaging	Het
Msr1	T	A	8: 39,589,382	D384V	probably damaging	Het
Mtpap	A	C	18: 4,380,873	S184R	possibly damaging	Het
Npc1l1	G	A	11: 6,217,731	T1020M	probably benign	Het
Nphp4	A	G	4: 152,488,802	T66A	probably benign	Het
Olfr1049	T	A	2: 86,255,228	Q155L	probably benign	Het
Olfr1100	G	A	2: 86,977,959	T279I	probably damaging	Het
Olfr1306	C	A	2: 111,912,256	V225L	probably benign	Het
Olfr98	T	A	17: 37,262,734	*310L	probably null	Het
Phf11d	G	T	14: 59,353,374	T178K	probably benign	Het
Ppm1d	A	G	11: 85,337,151	K298E	possibly damaging	Het
Rab2b	A	T	14: 52,266,233	I144K	probably benign	Het
Stoml1	A	G	9: 58,260,240	D5G	probably damaging	Het
Tanc1	T	C	2: 59,795,844	V515A	probably damaging	Het
Tas1r3	A	G	4: 155,862,904	V108A	possibly damaging	Het
Tcrg-C4	T	A	13: 19,344,825		probably benign	Het
Tifab	T	C	13: 56,176,246	Y128C	probably benign	Het
Tmc6	G	T	11: 117,774,257	R397S	probably damaging	Het
Tnpo3	C	T	6: 29,589,163	A63T	probably damaging	Het
Usp16	G	T	16: 87,471,836	C284F	probably damaging	Het
Wipf1	T	C	2: 73,437,097	D319G	probably damaging	Het
Xpnpep3	T	A	15: 81,442,448	W347R	probably damaging	Het
Zfp180	G	T	7: 24,105,112	E319*	probably null	Het

Other mutations in Ankfy1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00775:Ankfy1	APN	11	72728772	missense	probably benign	0.03
IGL00837:Ankfy1	APN	11	72755898	splice site	probably benign
IGL01061:Ankfy1	APN	11	72728860	nonsense	probably null
IGL01305:Ankfy1	APN	11	72764791	missense	probably damaging	1.00
IGL01599:Ankfy1	APN	11	72738365	missense	probably benign
IGL01918:Ankfy1	APN	11	72740455	missense	probably benign	0.09
IGL03007:Ankfy1	APN	11	72750521	missense	probably damaging	0.98
IGL03134:Ankfy1	APN	11	72712185	missense	probably damaging	1.00
IGL03182:Ankfy1	APN	11	72728754	splice site	probably benign
Betruenken	UTSW	11	72753608	missense	possibly damaging	0.78
Inebriated	UTSW	11	72752105	missense	probably benign
Smashed	UTSW	11	72712204	missense	probably damaging	1.00
woozy	UTSW	11	72754459	missense	probably benign	0.33
ANU22:Ankfy1	UTSW	11	72764791	missense	probably damaging	1.00
I2289:Ankfy1	UTSW	11	72730485	missense	probably benign	0.01
R0062:Ankfy1	UTSW	11	72712204	missense	probably damaging	1.00
R0062:Ankfy1	UTSW	11	72712204	missense	probably damaging	1.00
R0569:Ankfy1	UTSW	11	72753608	missense	possibly damaging	0.78
R0787:Ankfy1	UTSW	11	72760296	missense	probably damaging	1.00
R1303:Ankfy1	UTSW	11	72750071	splice site	probably null
R1522:Ankfy1	UTSW	11	72755867	nonsense	probably null
R1552:Ankfy1	UTSW	11	72754495	critical splice donor site	probably null
R1565:Ankfy1	UTSW	11	72757318	missense	probably damaging	1.00
R1899:Ankfy1	UTSW	11	72754407	nonsense	probably null
R1900:Ankfy1	UTSW	11	72754407	nonsense	probably null
R1950:Ankfy1	UTSW	11	72760329	missense	probably damaging	1.00
R2421:Ankfy1	UTSW	11	72755896	splice site	probably benign
R3429:Ankfy1	UTSW	11	72712154	splice site	probably benign
R3801:Ankfy1	UTSW	11	72749420	missense	probably benign
R4079:Ankfy1	UTSW	11	72690009	utr 5 prime	probably benign
R4119:Ankfy1	UTSW	11	72714484	critical splice donor site	probably null
R4120:Ankfy1	UTSW	11	72714484	critical splice donor site	probably null
R4165:Ankfy1	UTSW	11	72714484	critical splice donor site	probably null
R4233:Ankfy1	UTSW	11	72714484	critical splice donor site	probably null
R4234:Ankfy1	UTSW	11	72714484	critical splice donor site	probably null
R4236:Ankfy1	UTSW	11	72714484	critical splice donor site	probably null
R4735:Ankfy1	UTSW	11	72730611	missense	probably benign
R4765:Ankfy1	UTSW	11	72712291	missense	probably benign	0.05
R4904:Ankfy1	UTSW	11	72752105	missense	probably benign
R5057:Ankfy1	UTSW	11	72759919	missense	probably damaging	1.00
R5454:Ankfy1	UTSW	11	72746931	missense	probably benign	0.00
R5471:Ankfy1	UTSW	11	72728791	missense	probably benign	0.01
R5737:Ankfy1	UTSW	11	72732274	missense	probably damaging	0.98
R5770:Ankfy1	UTSW	11	72760256	missense	probably damaging	1.00
R5896:Ankfy1	UTSW	11	72759985	missense	probably damaging	0.98
R5930:Ankfy1	UTSW	11	72712245	missense	probably benign	0.00
R5960:Ankfy1	UTSW	11	72757352	missense	possibly damaging	0.91
R6169:Ankfy1	UTSW	11	72754459	missense	probably benign	0.33
R6176:Ankfy1	UTSW	11	72754459	missense	probably benign	0.33
R6177:Ankfy1	UTSW	11	72754459	missense	probably benign	0.33
R6178:Ankfy1	UTSW	11	72754459	missense	probably benign	0.33
R6477:Ankfy1	UTSW	11	72730482	missense	possibly damaging	0.76
R6513:Ankfy1	UTSW	11	72730482	missense	possibly damaging	0.76
R6521:Ankfy1	UTSW	11	72730482	missense	possibly damaging	0.76
R6523:Ankfy1	UTSW	11	72730482	missense	possibly damaging	0.76
R6524:Ankfy1	UTSW	11	72730482	missense	possibly damaging	0.76
R7329:Ankfy1	UTSW	11	72712208	missense	probably damaging	0.96
R7393:Ankfy1	UTSW	11	72738308	missense	possibly damaging	0.70
R7410:Ankfy1	UTSW	11	72761504	missense	probably damaging	1.00
R7488:Ankfy1	UTSW	11	72759943	missense	probably benign	0.05
R7731:Ankfy1	UTSW	11	72712281	missense	probably benign	0.00
R7810:Ankfy1	UTSW	11	72754455	nonsense	probably null
R8236:Ankfy1	UTSW	11	72754355	missense	possibly damaging	0.90
R8709:Ankfy1	UTSW	11	72755706	missense	possibly damaging	0.91
R8717:Ankfy1	UTSW	11	72730474	missense	probably benign	0.01
R8839:Ankfy1	UTSW	11	72730566	missense	probably benign	0.39
R8862:Ankfy1	UTSW	11	72753643	missense	probably benign	0.18
R8954:Ankfy1	UTSW	11	72750491	missense	possibly damaging	0.91
R9548:Ankfy1	UTSW	11	72750179	critical splice donor site	probably null
R9762:Ankfy1	UTSW	11	72730575	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAACAGTACGTAGGGCGGC -3'
(R):5'- CCAGATGGCCTACTGTTTCC -3'

Sequencing Primer
(F):5'- GCAGGCCTGAAATTTAGAGTCCC -3'
(R):5'- AGATGGCCTACTGTTTCCCAGAG -3'

Posted On

2019-05-13