Incidental Mutation 'R7006:Tmc6'
ID544730
Institutional Source Beutler Lab
Gene Symbol Tmc6
Ensembl Gene ENSMUSG00000025572
Gene Nametransmembrane channel-like gene family 6
SynonymsD11Ertd204e, EVER1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7006 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location117765988-117782198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117774257 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 397 (R397S)
Ref Sequence ENSEMBL: ENSMUSP00000026659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000103025] [ENSMUST00000127227] [ENSMUST00000131606] [ENSMUST00000136729] [ENSMUST00000143406] [ENSMUST00000152304]
Predicted Effect probably damaging
Transcript: ENSMUST00000026659
AA Change: R397S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572
AA Change: R397S

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103025
SMART Domains Protein: ENSMUSP00000099314
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127227
Predicted Effect probably benign
Transcript: ENSMUST00000131606
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136729
SMART Domains Protein: ENSMUSP00000118068
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143406
SMART Domains Protein: ENSMUSP00000117566
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149589
SMART Domains Protein: ENSMUSP00000116521
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
Pfam:TMC 61 108 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152304
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Tmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Tmc6 APN 11 117779046 missense probably damaging 0.99
IGL02637:Tmc6 APN 11 117767590 missense possibly damaging 0.94
PIT4520001:Tmc6 UTSW 11 117772730 missense possibly damaging 0.55
R0140:Tmc6 UTSW 11 117766251 unclassified probably benign
R0149:Tmc6 UTSW 11 117769448 missense probably damaging 1.00
R0437:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R1566:Tmc6 UTSW 11 117769436 missense probably damaging 0.99
R2011:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2012:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2169:Tmc6 UTSW 11 117769106 missense probably damaging 1.00
R2568:Tmc6 UTSW 11 117772820 missense probably benign 0.08
R3853:Tmc6 UTSW 11 117773058 nonsense probably null
R4049:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R4655:Tmc6 UTSW 11 117773042 missense possibly damaging 0.62
R4708:Tmc6 UTSW 11 117768948 missense probably benign 0.00
R5001:Tmc6 UTSW 11 117770784 missense probably benign 0.28
R5115:Tmc6 UTSW 11 117775188 missense probably damaging 0.98
R5551:Tmc6 UTSW 11 117769445 missense probably damaging 1.00
R5667:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5671:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5763:Tmc6 UTSW 11 117769433 missense possibly damaging 0.90
R6137:Tmc6 UTSW 11 117776328 missense probably damaging 1.00
R6354:Tmc6 UTSW 11 117774236 missense probably benign 0.32
R6418:Tmc6 UTSW 11 117770500 missense probably damaging 0.99
R6868:Tmc6 UTSW 11 117774317 missense probably benign 0.01
R7208:Tmc6 UTSW 11 117776325 missense probably benign 0.41
R7210:Tmc6 UTSW 11 117775844 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TAGGGAAAGACCACCACAGC -3'
(R):5'- TCCCATCTATCCACATAGCCAT -3'

Sequencing Primer
(F):5'- GCCCAGAACCTCAAGGC -3'
(R):5'- ATCCACATAGCCATCTATCTATCATC -3'
Posted On2019-05-13