Incidental Mutation 'R7006:Rab2b'
ID544736
Institutional Source Beutler Lab
Gene Symbol Rab2b
Ensembl Gene ENSMUSG00000022159
Gene NameRAB2B, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7006 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52261759-52279545 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52266233 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 144 (I144K)
Ref Sequence ENSEMBL: ENSMUSP00000131145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022765] [ENSMUST00000100631] [ENSMUST00000167116] [ENSMUST00000172488] [ENSMUST00000174020]
Predicted Effect probably benign
Transcript: ENSMUST00000022765
AA Change: I144K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022765
Gene: ENSMUSG00000022159
AA Change: I144K

DomainStartEndE-ValueType
RAB 7 170 7.66e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100631
AA Change: I144K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098197
Gene: ENSMUSG00000022159
AA Change: I144K

DomainStartEndE-ValueType
RAB 7 168 6.88e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167116
AA Change: I144K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131145
Gene: ENSMUSG00000022159
AA Change: I144K

DomainStartEndE-ValueType
RAB 7 170 7.66e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172488
SMART Domains Protein: ENSMUSP00000133787
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
Pfam:Miro 8 62 3.5e-7 PFAM
Pfam:Ras 8 62 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172634
Predicted Effect probably benign
Transcript: ENSMUST00000174020
SMART Domains Protein: ENSMUSP00000134726
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
small_GTPase 7 70 5.2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Rab protein family are nontransforming monomeric GTP-binding proteins of the Ras superfamily that contain 4 highly conserved regions involved in GTP binding and hydrolysis. Rab proteins are prenylated, membrane-bound proteins involved in vesicular fusion and trafficking; see MIM 179508.[supplied by OMIM, Apr 2006]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Rab2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Rab2b APN 14 52268696 missense probably damaging 0.99
R4631:Rab2b UTSW 14 52266242 missense possibly damaging 0.86
R6418:Rab2b UTSW 14 52268707 utr 3 prime probably benign
R7166:Rab2b UTSW 14 52279345 unclassified probably benign
R7721:Rab2b UTSW 14 52263760 missense probably benign
R7739:Rab2b UTSW 14 52266260 missense probably damaging 0.99
R8051:Rab2b UTSW 14 52268696 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAAATAACAGTGGGGTCTAATCC -3'
(R):5'- CATTTCAAGGACCAACTGGCG -3'

Sequencing Primer
(F):5'- CAGTGGGGTCTAATCCATATATACC -3'
(R):5'- GACCAACTGGCGGTTTTAAACTG -3'
Posted On2019-05-13