Incidental Mutation 'R7006:Xpnpep3'
ID544739
Institutional Source Beutler Lab
Gene Symbol Xpnpep3
Ensembl Gene ENSMUSG00000022401
Gene NameX-prolyl aminopeptidase 3, mitochondrial
SynonymsE430012M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7006 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81400138-81457482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81442448 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 347 (W347R)
Ref Sequence ENSEMBL: ENSMUSP00000132822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041609] [ENSMUST00000163754] [ENSMUST00000165258]
Predicted Effect probably damaging
Transcript: ENSMUST00000041609
AA Change: W347R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038331
Gene: ENSMUSG00000022401
AA Change: W347R

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 366 1.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163754
AA Change: W347R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132822
Gene: ENSMUSG00000022401
AA Change: W347R

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 481 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165258
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Usp16 G T 16: 87,471,836 C284F probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Xpnpep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Xpnpep3 APN 15 81436768 missense possibly damaging 0.93
IGL01292:Xpnpep3 APN 15 81427498 missense probably damaging 1.00
IGL02219:Xpnpep3 APN 15 81427456 missense probably damaging 1.00
zebra UTSW 15 81430842 missense probably damaging 1.00
FR4449:Xpnpep3 UTSW 15 81427422 missense possibly damaging 0.96
R0069:Xpnpep3 UTSW 15 81430798 missense probably benign 0.18
R0069:Xpnpep3 UTSW 15 81430798 missense probably benign 0.18
R0304:Xpnpep3 UTSW 15 81430714 missense probably damaging 1.00
R0518:Xpnpep3 UTSW 15 81427492 missense possibly damaging 0.94
R0521:Xpnpep3 UTSW 15 81427492 missense possibly damaging 0.94
R0639:Xpnpep3 UTSW 15 81430837 missense probably benign 0.32
R0725:Xpnpep3 UTSW 15 81430842 missense probably damaging 1.00
R1674:Xpnpep3 UTSW 15 81430767 missense probably benign
R1840:Xpnpep3 UTSW 15 81427353 missense probably benign 0.00
R2571:Xpnpep3 UTSW 15 81450926 missense probably damaging 1.00
R3956:Xpnpep3 UTSW 15 81451029 splice site probably benign
R4242:Xpnpep3 UTSW 15 81427656 missense probably benign 0.05
R4997:Xpnpep3 UTSW 15 81448376 nonsense probably null
R5635:Xpnpep3 UTSW 15 81436769 missense probably benign 0.40
R5789:Xpnpep3 UTSW 15 81415864 intron probably benign
R6190:Xpnpep3 UTSW 15 81438099 missense probably benign 0.00
R7295:Xpnpep3 UTSW 15 81414534 missense probably damaging 0.99
R7353:Xpnpep3 UTSW 15 81430887 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TAAACTAGGAGGAGTTTGCATGGTG -3'
(R):5'- TGCCTTACTATGCTATGAAATGAAC -3'

Sequencing Primer
(F):5'- CAACTTTCTGTGGATTCCAGGGAAC -3'
(R):5'- TGAAATGAACAAAATTGCTAACCCC -3'
Posted On2019-05-13