Incidental Mutation 'R7006:Usp16'
ID 544740
Institutional Source Beutler Lab
Gene Symbol Usp16
Ensembl Gene ENSMUSG00000025616
Gene Name ubiquitin specific peptidase 16
Synonyms 2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 87454703-87483517 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 87471836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 284 (C284F)
Ref Sequence ENSEMBL: ENSMUSP00000116323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759]
AlphaFold Q99LG0
Predicted Effect probably damaging
Transcript: ENSMUST00000026710
AA Change: C285F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: C285F

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119504
AA Change: C284F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: C284F

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144759
AA Change: C284F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616
AA Change: C284F

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 G A 13: 68,888,020 T174M probably damaging Het
Ankfy1 T A 11: 72,740,464 I412N probably benign Het
AW146154 T C 7: 41,481,224 E156G possibly damaging Het
B4galnt1 T C 10: 127,169,831 L267P probably benign Het
Bod1l T C 5: 41,832,552 E276G probably damaging Het
Ccdc187 T C 2: 26,281,090 T459A probably benign Het
Cep72 G A 13: 74,050,308 Q311* probably null Het
Cir1 T C 2: 73,310,490 Q45R probably damaging Het
Ciz1 T C 2: 32,371,115 probably null Het
Crtap G T 9: 114,386,323 A166E probably damaging Het
Dmp1 A G 5: 104,212,322 D288G probably benign Het
Dusp27 T C 1: 166,099,094 N983S probably benign Het
Fam69a A G 5: 107,910,161 V132A probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmnl2 C A 2: 53,108,254 Q544K probably benign Het
Gm13178 A G 4: 144,721,283 V41A probably benign Het
Gm6657 T A 12: 78,208,928 *177R probably null Het
Gpsm1 T C 2: 26,322,560 L72P probably damaging Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Kcnq3 A C 15: 66,020,316 Y403* probably null Het
Kcp A C 6: 29,499,170 Y298D probably damaging Het
Kif5c T C 2: 49,735,514 S599P probably damaging Het
Krt20 A T 11: 99,437,761 Y113N probably benign Het
Mcm8 T G 2: 132,823,261 V191G probably damaging Het
Msr1 T A 8: 39,589,382 D384V probably damaging Het
Mtpap A C 18: 4,380,873 S184R possibly damaging Het
Npc1l1 G A 11: 6,217,731 T1020M probably benign Het
Nphp4 A G 4: 152,488,802 T66A probably benign Het
Olfr1049 T A 2: 86,255,228 Q155L probably benign Het
Olfr1100 G A 2: 86,977,959 T279I probably damaging Het
Olfr1306 C A 2: 111,912,256 V225L probably benign Het
Olfr98 T A 17: 37,262,734 *310L probably null Het
Phf11d G T 14: 59,353,374 T178K probably benign Het
Ppm1d A G 11: 85,337,151 K298E possibly damaging Het
Rab2b A T 14: 52,266,233 I144K probably benign Het
Stoml1 A G 9: 58,260,240 D5G probably damaging Het
Tanc1 T C 2: 59,795,844 V515A probably damaging Het
Tas1r3 A G 4: 155,862,904 V108A possibly damaging Het
Tcrg-C4 T A 13: 19,344,825 probably benign Het
Tifab T C 13: 56,176,246 Y128C probably benign Het
Tmc6 G T 11: 117,774,257 R397S probably damaging Het
Tnpo3 C T 6: 29,589,163 A63T probably damaging Het
Wipf1 T C 2: 73,437,097 D319G probably damaging Het
Xpnpep3 T A 15: 81,442,448 W347R probably damaging Het
Zfp180 G T 7: 24,105,112 E319* probably null Het
Other mutations in Usp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Usp16 APN 16 87466276 missense possibly damaging 0.95
IGL01589:Usp16 APN 16 87479183 missense probably benign 0.00
IGL02570:Usp16 APN 16 87480893 missense probably damaging 1.00
IGL02736:Usp16 APN 16 87464835 missense possibly damaging 0.75
IGL02973:Usp16 APN 16 87479739 missense probably damaging 1.00
IGL03066:Usp16 APN 16 87471833 missense probably damaging 1.00
PIT1430001:Usp16 UTSW 16 87473132 missense probably damaging 0.99
R0395:Usp16 UTSW 16 87475446 missense probably damaging 1.00
R0619:Usp16 UTSW 16 87472164 missense probably benign 0.02
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1549:Usp16 UTSW 16 87464834 missense probably damaging 1.00
R1557:Usp16 UTSW 16 87462142 critical splice donor site probably null
R1776:Usp16 UTSW 16 87479316 missense probably damaging 0.97
R1818:Usp16 UTSW 16 87479132 nonsense probably null
R1835:Usp16 UTSW 16 87480907 missense probably damaging 1.00
R2022:Usp16 UTSW 16 87473126 missense probably damaging 1.00
R2146:Usp16 UTSW 16 87473187 critical splice donor site probably null
R2432:Usp16 UTSW 16 87466358 critical splice donor site probably null
R3110:Usp16 UTSW 16 87471848 splice site probably null
R3112:Usp16 UTSW 16 87471848 splice site probably null
R3771:Usp16 UTSW 16 87458683 start codon destroyed probably null 1.00
R4353:Usp16 UTSW 16 87470354 missense probably damaging 1.00
R4959:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R4973:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R5276:Usp16 UTSW 16 87470451 critical splice donor site probably null
R5753:Usp16 UTSW 16 87482899 missense probably damaging 0.98
R6230:Usp16 UTSW 16 87464798 missense possibly damaging 0.48
R6267:Usp16 UTSW 16 87483191 missense probably benign 0.00
R6473:Usp16 UTSW 16 87483135 missense probably benign 0.00
R6736:Usp16 UTSW 16 87470397 missense probably damaging 1.00
R7012:Usp16 UTSW 16 87458744 critical splice donor site probably null
R7040:Usp16 UTSW 16 87480929 missense probably damaging 1.00
R7136:Usp16 UTSW 16 87483171 missense probably benign
R7295:Usp16 UTSW 16 87472089 missense probably benign 0.44
R7434:Usp16 UTSW 16 87479319 nonsense probably null
R7497:Usp16 UTSW 16 87466286 nonsense probably null
R7571:Usp16 UTSW 16 87464835 missense possibly damaging 0.75
R7576:Usp16 UTSW 16 87479300 missense probably benign 0.34
R7624:Usp16 UTSW 16 87476805 missense probably benign 0.23
R7889:Usp16 UTSW 16 87474584 missense probably benign 0.44
R8499:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R8779:Usp16 UTSW 16 87479409 missense probably benign 0.00
R9182:Usp16 UTSW 16 87479654 missense probably benign 0.00
R9251:Usp16 UTSW 16 87469752 missense probably benign 0.08
R9367:Usp16 UTSW 16 87464781 missense probably benign 0.01
R9707:Usp16 UTSW 16 87466347 missense probably benign
R9746:Usp16 UTSW 16 87479232 missense probably benign 0.00
X0061:Usp16 UTSW 16 87479457 missense probably benign 0.01
X0064:Usp16 UTSW 16 87471725 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACATTGGTCAGCTCTGTCACG -3'
(R):5'- CTCAAACCTGTGTCTGCTGTACG -3'

Sequencing Primer
(F):5'- CGATCATCGGCTTGTCACG -3'
(R):5'- TCTGCTGTACGAAGAGCCTAG -3'
Posted On 2019-05-13