Incidental Mutation 'R7007:Jph1'
ID544743
Institutional Source Beutler Lab
Gene Symbol Jph1
Ensembl Gene ENSMUSG00000042686
Gene Namejunctophilin 1
SynonymsENSMUSG00000054314, mitsugumin72, JP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location16964560-17097889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17004186 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 11 (H11L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038382]
Predicted Effect probably benign
Transcript: ENSMUST00000038382
AA Change: H536L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039072
Gene: ENSMUSG00000042686
AA Change: H536L

DomainStartEndE-ValueType
MORN 12 33 7.31e-1 SMART
MORN 36 56 7.6e1 SMART
MORN 58 79 2.49e-1 SMART
Pfam:MORN 82 99 8.9e-3 PFAM
MORN 104 125 3.72e-4 SMART
MORN 127 148 7.86e-3 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
MORN 279 300 2.07e-2 SMART
MORN 302 323 2.86e-5 SMART
low complexity region 382 400 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186024
AA Change: H11L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to suckle and die shortly after birth. Mutants exhibit deficiencies of triad junctions and contraction in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Jph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Jph1 APN 1 17091740 missense probably damaging 1.00
IGL01382:Jph1 APN 1 17016156 missense probably damaging 1.00
IGL01936:Jph1 APN 1 17097384 missense probably damaging 0.98
IGL02012:Jph1 APN 1 17097414 missense probably benign 0.00
IGL02142:Jph1 APN 1 17091660 missense probably damaging 0.99
IGL02212:Jph1 APN 1 17091757 missense probably damaging 1.00
IGL02317:Jph1 APN 1 17003923 missense probably benign
IGL02450:Jph1 APN 1 17003977 missense possibly damaging 0.77
IGL02707:Jph1 APN 1 17004451 missense probably benign
R0668:Jph1 UTSW 1 17091671 missense probably damaging 1.00
R0893:Jph1 UTSW 1 17004283 nonsense probably null
R1308:Jph1 UTSW 1 17091694 missense probably damaging 1.00
R1318:Jph1 UTSW 1 16997490 missense probably damaging 1.00
R1495:Jph1 UTSW 1 17091652 missense probably benign
R1712:Jph1 UTSW 1 17097232 missense possibly damaging 0.57
R1916:Jph1 UTSW 1 17092055 missense probably damaging 1.00
R4492:Jph1 UTSW 1 16997546 missense probably damaging 1.00
R4559:Jph1 UTSW 1 17004511 missense probably benign
R4565:Jph1 UTSW 1 17004202 missense possibly damaging 0.91
R4694:Jph1 UTSW 1 16997505 missense probably damaging 0.98
R4700:Jph1 UTSW 1 17091704 missense possibly damaging 0.82
R4906:Jph1 UTSW 1 17091611 missense probably damaging 1.00
R5029:Jph1 UTSW 1 17091391 missense possibly damaging 0.85
R5256:Jph1 UTSW 1 17091398 missense probably benign 0.38
R5316:Jph1 UTSW 1 17091526 missense probably damaging 1.00
R5691:Jph1 UTSW 1 17004363 missense probably benign 0.21
R6209:Jph1 UTSW 1 17097586 missense probably damaging 0.98
R6380:Jph1 UTSW 1 17091847 missense probably damaging 1.00
R6645:Jph1 UTSW 1 17091761 missense probably damaging 1.00
R6829:Jph1 UTSW 1 17004423 missense probably damaging 1.00
R7276:Jph1 UTSW 1 17092042 missense probably damaging 1.00
R7689:Jph1 UTSW 1 17003968 nonsense probably null
R7719:Jph1 UTSW 1 17091991 missense probably damaging 1.00
R7792:Jph1 UTSW 1 17004378 missense probably benign 0.02
R8132:Jph1 UTSW 1 17016155 missense probably damaging 1.00
Z1176:Jph1 UTSW 1 17097352 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGCAACTGGTTTTGTCACAG -3'
(R):5'- CTGAGTCAAGTCCCAAACAGAG -3'

Sequencing Primer
(F):5'- GCAACTGGTTTTGTCACAGATTTAG -3'
(R):5'- AGAGCCACTCTCCCCAG -3'
Posted On2019-05-13