Incidental Mutation 'R7007:Srgap2'
ID544749
Institutional Source Beutler Lab
Gene Symbol Srgap2
Ensembl Gene ENSMUSG00000026425
Gene NameSLIT-ROBO Rho GTPase activating protein 2
SynonymsFBP2, Fnbp2, 9930124L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131285251-131527352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131319537 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 586 (I586V)
Ref Sequence ENSEMBL: ENSMUSP00000139405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097588] [ENSMUST00000185596] [ENSMUST00000186543]
Predicted Effect probably benign
Transcript: ENSMUST00000097588
AA Change: I586V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425
AA Change: I586V

DomainStartEndE-ValueType
FCH 22 120 7.33e-18 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 9.6e-60 SMART
SH3 731 786 4.52e-15 SMART
low complexity region 852 868 N/A INTRINSIC
coiled coil region 940 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185596
AA Change: I445V

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141140
Gene: ENSMUSG00000026425
AA Change: I445V

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
coiled coil region 222 260 N/A INTRINSIC
Blast:RhoGAP 304 349 5e-12 BLAST
RhoGAP 361 535 5.9e-62 SMART
SH3 590 645 2.8e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186543
AA Change: I586V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425
AA Change: I586V

DomainStartEndE-ValueType
FCH 22 120 3.7e-20 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 5.9e-62 SMART
SH3 731 786 2.8e-17 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogs on human chromosome 1 resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are born at below the expected Mendelian ratio, but are otherwise viable. Layer 5 cortical pyramidal neurons exhibit an increased density of dendritic spines with a decreased spine head width and increased length of spine necks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Srgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Srgap2 APN 1 131356700 missense possibly damaging 0.89
IGL01738:Srgap2 APN 1 131296426 missense probably benign 0.00
IGL01933:Srgap2 APN 1 131411855 missense probably damaging 1.00
IGL01964:Srgap2 APN 1 131289578 missense probably benign 0.08
IGL02028:Srgap2 APN 1 131296435 missense probably damaging 0.98
IGL02159:Srgap2 APN 1 131319666 splice site probably benign
IGL02326:Srgap2 APN 1 131356907 critical splice acceptor site probably null
IGL02396:Srgap2 APN 1 131292675 missense probably damaging 0.99
IGL02407:Srgap2 APN 1 131319602 missense probably damaging 1.00
IGL02444:Srgap2 APN 1 131325153 splice site probably null
IGL02559:Srgap2 APN 1 131524936 critical splice donor site probably null
IGL02900:Srgap2 APN 1 131411796 splice site probably benign
IGL03150:Srgap2 APN 1 131310600 missense probably damaging 1.00
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0044:Srgap2 UTSW 1 131319551 missense possibly damaging 0.68
R0441:Srgap2 UTSW 1 131336437 missense probably damaging 1.00
R0580:Srgap2 UTSW 1 131349501 missense possibly damaging 0.81
R0882:Srgap2 UTSW 1 131289515 missense probably benign 0.00
R1412:Srgap2 UTSW 1 131300413 missense possibly damaging 0.81
R1501:Srgap2 UTSW 1 131292699 missense probably damaging 1.00
R1740:Srgap2 UTSW 1 131289388 missense probably benign 0.00
R1764:Srgap2 UTSW 1 131319537 missense possibly damaging 0.94
R1772:Srgap2 UTSW 1 131319638 missense probably damaging 0.99
R1776:Srgap2 UTSW 1 131411850 missense probably damaging 1.00
R2393:Srgap2 UTSW 1 131332134 missense probably benign 0.00
R3011:Srgap2 UTSW 1 131310591 missense probably damaging 0.99
R3149:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3150:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3800:Srgap2 UTSW 1 131310559 missense probably damaging 1.00
R4871:Srgap2 UTSW 1 131289472 missense probably benign 0.00
R4884:Srgap2 UTSW 1 131292576 unclassified probably null
R5454:Srgap2 UTSW 1 131289737 missense probably benign 0.08
R5536:Srgap2 UTSW 1 131300390 splice site probably null
R6113:Srgap2 UTSW 1 131355505 splice site probably null
R6174:Srgap2 UTSW 1 131289616 missense probably benign 0.00
R6180:Srgap2 UTSW 1 131349541 missense probably benign 0.00
R6341:Srgap2 UTSW 1 131291629 missense probably benign 0.02
R6357:Srgap2 UTSW 1 131355542 missense probably damaging 1.00
R6363:Srgap2 UTSW 1 131298468 missense probably damaging 1.00
R6770:Srgap2 UTSW 1 131298510 missense probably benign 0.00
R6934:Srgap2 UTSW 1 131317231 missense possibly damaging 0.81
R7077:Srgap2 UTSW 1 131344449 missense
R7147:Srgap2 UTSW 1 131310594 missense
R7326:Srgap2 UTSW 1 131291613 nonsense probably null
R7467:Srgap2 UTSW 1 131292667 missense probably damaging 0.97
R7500:Srgap2 UTSW 1 131436831 missense probably damaging 1.00
R7579:Srgap2 UTSW 1 131292633 missense probably damaging 0.99
X0022:Srgap2 UTSW 1 131411949 missense probably benign 0.01
Z1177:Srgap2 UTSW 1 131355510 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGACAAGACTGGATCTTACGG -3'
(R):5'- CTGTGATTTGCCTAACTCGC -3'

Sequencing Primer
(F):5'- AAGGAGTCTTGACTTAAATTCTATGC -3'
(R):5'- CTTTCTTTCCTTTCGGACTGGGG -3'
Posted On2019-05-13