Incidental Mutation 'R7007:Ptges2'
ID544754
Institutional Source Beutler Lab
Gene Symbol Ptges2
Ensembl Gene ENSMUSG00000026820
Gene Nameprostaglandin E synthase 2
SynonymsGBF1, GBF-1, 0610038H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32395896-32405772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32402306 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000028162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028162] [ENSMUST00000123714]
Predicted Effect probably benign
Transcript: ENSMUST00000028162
AA Change: V378A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028162
Gene: ENSMUSG00000026820
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 57 71 N/A INTRINSIC
Pfam:Glutaredoxin 101 156 4.6e-10 PFAM
Pfam:GST_N_3 103 174 4.5e-14 PFAM
Pfam:GST_N_2 108 174 2.5e-9 PFAM
Pfam:GST_C_3 223 367 6.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123714
SMART Domains Protein: ENSMUSP00000141638
Gene: ENSMUSG00000026820

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a Golgi membrane-associated prostaglandin E synthase candidate, which is capable of catalyzing the conversion of prostaglandin H2 to prostaglandin E2 in vitro. However, a study using mice deficient of this gene suggests that this enzyme does not contribute to prostaglandin E2 biosynthesis in vivo. This protein is synthesized as a Golgi membrane-bound protein, but its N-terminal hydrophobic region is cleaved off during protein maturation to produce the predominant soluble truncated form that still retains the enzyme activity. This soluble protein also has been shown to activate the transcription regulated by a gamma-interferon-activated transcription element (GATE), possibly via an interaction with CAAAT/enhancer-binding protein-beta. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal basal prostaglandin E2 (PGE2) protein levels in the lactating mammary gland. Mice homozygous for a different knock-out allele exhibit increased sensitivity to IgE antigen-dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Ptges2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Ptges2 APN 2 32401530 missense possibly damaging 0.89
IGL02484:Ptges2 APN 2 32397707 missense probably damaging 1.00
R1463:Ptges2 UTSW 2 32400862 intron probably null
R1993:Ptges2 UTSW 2 32400092 missense probably benign 0.25
R3151:Ptges2 UTSW 2 32396476 missense probably benign 0.01
R4795:Ptges2 UTSW 2 32396322 nonsense probably null
R6974:Ptges2 UTSW 2 32397671 missense possibly damaging 0.55
R7881:Ptges2 UTSW 2 32402231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACACAACTGGCAGCAG -3'
(R):5'- AAGTTTGGGCCTTGTCCTC -3'

Sequencing Primer
(F):5'- AGGCAGTGTGGATGCCTCATC -3'
(R):5'- TTGTCCTCAGCGTCAAGGG -3'
Posted On2019-05-13