Incidental Mutation 'R7007:Apoc2'
ID544771
Institutional Source Beutler Lab
Gene Symbol Apoc2
Ensembl Gene ENSMUSG00000002992
Gene Nameapolipoprotein C-II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19671579-19677941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19673357 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 26 (D26E)
Ref Sequence ENSEMBL: ENSMUSP00000114512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003071] [ENSMUST00000003074] [ENSMUST00000127648] [ENSMUST00000134116] [ENSMUST00000142352] [ENSMUST00000150569]
Predicted Effect probably benign
Transcript: ENSMUST00000003071
SMART Domains Protein: ENSMUSP00000003071
Gene: ENSMUSG00000074336

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:APOC4 28 121 9.6e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000003074
AA Change: D26E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003074
Gene: ENSMUSG00000002992
AA Change: D26E

DomainStartEndE-ValueType
Pfam:Apo-CII 20 97 4.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127648
AA Change: D26E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118305
Gene: ENSMUSG00000109350
AA Change: D26E

DomainStartEndE-ValueType
Pfam:Apo-CII 20 68 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134116
AA Change: D26E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118291
Gene: ENSMUSG00000002992
AA Change: D26E

DomainStartEndE-ValueType
Pfam:Apo-CII 20 97 4.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142352
AA Change: D26E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115173
Gene: ENSMUSG00000002992
AA Change: D26E

DomainStartEndE-ValueType
Pfam:Apo-CII 21 97 1.8e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150569
AA Change: D26E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114512
Gene: ENSMUSG00000109350
AA Change: D26E

DomainStartEndE-ValueType
Pfam:Apo-CII 20 97 4.4e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for an endonuclease-mediated allele exhibit increased circulating triglyceride, decreased circulating HDL cholesterol, and abnormal lipoprotein levels. Mice heterozygous for the allele exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Apoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0609:Apoc2 UTSW 7 19673353 missense probably benign
R6248:Apoc2 UTSW 7 19673568 missense probably benign 0.00
RF009:Apoc2 UTSW 7 19671842 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGCATATGCCGGGATCTG -3'
(R):5'- CTTAATGCTCCAGGTCCCAG -3'

Sequencing Primer
(F):5'- TTGGCAGAGGTCCAGTAA -3'
(R):5'- TCCAGGTCCCAGACAGCATG -3'
Posted On2019-05-13