Incidental Mutation 'R7007:Vrk3'
ID544772
Institutional Source Beutler Lab
Gene Symbol Vrk3
Ensembl Gene ENSMUSG00000002205
Gene Namevaccinia related kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44748413-44777515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44757763 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 53 (N53D)
Ref Sequence ENSEMBL: ENSMUSP00000119073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002275] [ENSMUST00000125705] [ENSMUST00000144515] [ENSMUST00000147952] [ENSMUST00000165957] [ENSMUST00000171821]
Predicted Effect probably benign
Transcript: ENSMUST00000002275
AA Change: N53D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000002275
Gene: ENSMUSG00000002205
AA Change: N53D

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 212 432 3.2e-8 PFAM
Pfam:Pkinase 218 432 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125705
Predicted Effect probably damaging
Transcript: ENSMUST00000144515
AA Change: N53D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119073
Gene: ENSMUSG00000002205
AA Change: N53D

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.2e-11 PFAM
Pfam:zinc_ribbon_2 4 26 3e-10 PFAM
PDB:2JII|B 97 176 3e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147952
AA Change: N53D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130331
Gene: ENSMUSG00000002205
AA Change: N53D

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.1e-11 PFAM
Pfam:zinc_ribbon_2 4 26 2.9e-10 PFAM
PDB:2JII|B 117 162 1e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000165957
AA Change: N53D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131704
Gene: ENSMUSG00000002205
AA Change: N53D

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 6.7e-12 PFAM
Pfam:zinc_ribbon_2 4 26 4.4e-10 PFAM
PDB:2JII|B 117 204 7e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171821
AA Change: N53D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132748
Gene: ENSMUSG00000002205
AA Change: N53D

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 2.9e-12 PFAM
Pfam:zinc_ribbon_2 4 26 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. In both human and mouse, this gene has substitutions at several residues within the ATP binding motifs that in other kinases have been shown to be required for catalysis. In vitro assays indicate the protein lacks phosphorylation activity. The protein, however, likely retains its substrate binding capability. This gene is widely expressed in human tissues and its protein localizes to the nucleus. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired social behavior, decreased fear and anxiety relate behavior, impaired spatial memory, and abnormal hippocampal dendritic spine and synapse morphologies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Vrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Vrk3 APN 7 44769647 missense probably damaging 1.00
IGL01540:Vrk3 APN 7 44767144 missense probably damaging 1.00
IGL02682:Vrk3 APN 7 44753820 missense probably benign 0.19
R0462:Vrk3 UTSW 7 44764200 missense possibly damaging 0.77
R0831:Vrk3 UTSW 7 44764803 missense probably damaging 1.00
R1760:Vrk3 UTSW 7 44768471 missense probably damaging 0.98
R2212:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2289:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2915:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3027:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3028:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3416:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3417:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3613:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3877:Vrk3 UTSW 7 44763036 unclassified probably null
R4357:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4359:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4379:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4381:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4439:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4441:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4773:Vrk3 UTSW 7 44775476 missense probably benign
R5222:Vrk3 UTSW 7 44759796 missense possibly damaging 0.67
R5808:Vrk3 UTSW 7 44759874 missense probably damaging 0.96
R6180:Vrk3 UTSW 7 44769611 missense possibly damaging 0.50
R7058:Vrk3 UTSW 7 44768466 missense probably damaging 0.98
R7425:Vrk3 UTSW 7 44770924 critical splice donor site probably null
R7995:Vrk3 UTSW 7 44764161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCAGAAGACATCAGAATGAC -3'
(R):5'- ACCAAATGATCCACCTTTGTCTCAC -3'

Sequencing Primer
(F):5'- CATCAGAATGACAGGTGATGGAC -3'
(R):5'- TCTCACCCAGACAAGGACCAG -3'
Posted On2019-05-13