Incidental Mutation 'R7007:Olfr1383'
ID544780
Institutional Source Beutler Lab
Gene Symbol Olfr1383
Ensembl Gene ENSMUSG00000107417
Gene Nameolfactory receptor 1383
SynonymsMOR256-56, GA_x6K02T2QP88-5912627-5911692
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7007 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49519648-49527199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49524184 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 154 (V154M)
Ref Sequence ENSEMBL: ENSMUSP00000145258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077143] [ENSMUST00000204706] [ENSMUST00000213152] [ENSMUST00000213707] [ENSMUST00000213899] [ENSMUST00000217564]
Predicted Effect probably benign
Transcript: ENSMUST00000077143
AA Change: V154M

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076390
Gene: ENSMUSG00000107417
AA Change: V154M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204706
AA Change: V154M

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145258
Gene: ENSMUSG00000107417
AA Change: V154M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213152
Predicted Effect probably benign
Transcript: ENSMUST00000213707
Predicted Effect probably benign
Transcript: ENSMUST00000213899
Predicted Effect probably benign
Transcript: ENSMUST00000217564
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Olfr1383
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02193:Olfr1383 APN 11 49523744 missense possibly damaging 0.56
IGL03178:Olfr1383 APN 11 49523990 missense possibly damaging 0.90
R0089:Olfr1383 UTSW 11 49524206 missense possibly damaging 0.67
R0112:Olfr1383 UTSW 11 49524134 missense possibly damaging 0.70
R0243:Olfr1383 UTSW 11 49523912 missense probably damaging 1.00
R0445:Olfr1383 UTSW 11 49523957 missense probably damaging 1.00
R0646:Olfr1383 UTSW 11 49524578 missense probably damaging 1.00
R1695:Olfr1383 UTSW 11 49524335 missense probably benign 0.32
R2142:Olfr1383 UTSW 11 49523839 missense probably benign 0.00
R3898:Olfr1383 UTSW 11 49524559 missense probably damaging 0.98
R4085:Olfr1383 UTSW 11 49524128 missense probably benign 0.23
R5677:Olfr1383 UTSW 11 49523944 missense probably damaging 0.98
R6187:Olfr1383 UTSW 11 49523511 unclassified probably benign
R6272:Olfr1383 UTSW 11 49524126 missense possibly damaging 0.67
R6287:Olfr1383 UTSW 11 49524245 missense probably damaging 0.99
R6898:Olfr1383 UTSW 11 49523709 unclassified probably benign
R7452:Olfr1383 UTSW 11 49524381 missense probably benign 0.03
R7699:Olfr1383 UTSW 11 49524554 missense probably damaging 1.00
R7700:Olfr1383 UTSW 11 49524554 missense probably damaging 1.00
X0017:Olfr1383 UTSW 11 49524002 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCTATGCTGGGTGTATGACC -3'
(R):5'- GATCTTCAACACTGCATGAGC -3'

Sequencing Primer
(F):5'- GTGTATGACCCAGTTCTTCATAGTGC -3'
(R):5'- GCATAGGTGCCTAGAATTAGTGCTAC -3'
Posted On2019-05-13