Incidental Mutation 'R7007:Adcy8'
ID544791
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
MMRRC Submission
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64704716 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 999 (N999S)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023007
AA Change: N999S

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: N999S

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228014
AA Change: N969S

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 unclassified probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64921033 missense probably benign
R7644:Adcy8 UTSW 15 64699369 missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64747001 missense probably benign
R7735:Adcy8 UTSW 15 64783780 missense probably benign 0.10
R7789:Adcy8 UTSW 15 64871774 nonsense probably null
R7860:Adcy8 UTSW 15 64699473 missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64920205 missense possibly damaging 0.60
R7943:Adcy8 UTSW 15 64699473 missense probably damaging 0.97
R7948:Adcy8 UTSW 15 64815350 missense possibly damaging 0.80
R7977:Adcy8 UTSW 15 64920205 missense possibly damaging 0.60
R8024:Adcy8 UTSW 15 64920246 missense probably damaging 1.00
R8158:Adcy8 UTSW 15 64783806 missense probably benign 0.32
Z1176:Adcy8 UTSW 15 64725518 missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64699177 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTAACTAAAACGGTTGAGCATCC -3'
(R):5'- ATTCCTGTGCACATGTCTGC -3'

Sequencing Primer
(F):5'- TGGACACCATTGCACACTGTG -3'
(R):5'- ACATGTCTGCCGGGTCCTTATG -3'
Posted On2019-05-13