Incidental Mutation 'R7007:Ciita'
ID544794
Institutional Source Beutler Lab
Gene Symbol Ciita
Ensembl Gene ENSMUSG00000022504
Gene Nameclass II transactivator
SynonymsC2ta, Gm9475
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location10480059-10528418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10511307 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 482 (L482P)
Ref Sequence ENSEMBL: ENSMUSP00000154946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023147] [ENSMUST00000184863] [ENSMUST00000230146] [ENSMUST00000230395] [ENSMUST00000230450]
Predicted Effect probably damaging
Transcript: ENSMUST00000023147
AA Change: L485P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023147
Gene: ENSMUSG00000022504
AA Change: L485P

DomainStartEndE-ValueType
low complexity region 216 230 N/A INTRINSIC
Pfam:NACHT 362 533 1.8e-44 PFAM
low complexity region 847 861 N/A INTRINSIC
LRR 931 961 8.53e0 SMART
LRR 962 989 7.37e-4 SMART
LRR 991 1018 1.25e-6 SMART
LRR 1019 1046 2.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184863
SMART Domains Protein: ENSMUSP00000139108
Gene: ENSMUSG00000038055

DomainStartEndE-ValueType
Pfam:Dexa_ind 1 95 4.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230146
AA Change: L482P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230395
AA Change: L562P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230450
AA Change: L461P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: This gene encodes a member of the NOD-like receptor protein family. This protein acts as a transcriptional coactivator and component of the enhanceosome complex to stimulate transcription of MHC class II genes in the adaptive immune response. This protein may also regulate the transcription of MHC class I genes. Mutations in the human gene have been linked to a rare immunodeficiency, bare lymphocyte syndrome, and homozygous knockout mice exhibit many features of this disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are immunologically abnormal with extremely little MHC class II expression, greatly reduced serum IgG, and impaired T-dependent antigen responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Ciita
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Ciita APN 16 10510727 missense probably damaging 0.99
IGL01830:Ciita APN 16 10521051 missense probably damaging 1.00
IGL02557:Ciita APN 16 10512015 missense probably damaging 1.00
IGL02634:Ciita APN 16 10508713 missense probably damaging 1.00
IGL03057:Ciita APN 16 10520959 splice site probably benign
IGL03403:Ciita APN 16 10503872 missense probably damaging 1.00
deshabille UTSW 16 10509207 splice site probably null
sisal UTSW 16 10513288 critical splice donor site probably null
R0001:Ciita UTSW 16 10514433 splice site probably benign
R0138:Ciita UTSW 16 10512270 missense probably damaging 1.00
R0583:Ciita UTSW 16 10523804 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R2017:Ciita UTSW 16 10511676 missense probably damaging 1.00
R2072:Ciita UTSW 16 10518353 missense probably benign 0.16
R2410:Ciita UTSW 16 10510704 missense probably damaging 0.99
R4779:Ciita UTSW 16 10511366 missense probably damaging 1.00
R5151:Ciita UTSW 16 10523730 missense probably damaging 1.00
R5233:Ciita UTSW 16 10509401 missense possibly damaging 0.95
R5363:Ciita UTSW 16 10512167 missense probably damaging 1.00
R5431:Ciita UTSW 16 10523792 missense probably damaging 1.00
R5821:Ciita UTSW 16 10511805 missense possibly damaging 0.77
R6085:Ciita UTSW 16 10512165 missense probably benign 0.08
R6088:Ciita UTSW 16 10511931 missense probably damaging 1.00
R6241:Ciita UTSW 16 10511903 missense probably damaging 1.00
R6354:Ciita UTSW 16 10523746 missense probably damaging 1.00
R6502:Ciita UTSW 16 10511910 missense probably damaging 1.00
R6553:Ciita UTSW 16 10511745 missense probably benign 0.00
R6585:Ciita UTSW 16 10511745 missense probably benign 0.00
R6916:Ciita UTSW 16 10509207 splice site probably null
R6937:Ciita UTSW 16 10512491 splice site probably null
R7219:Ciita UTSW 16 10512257 missense probably benign 0.00
R7326:Ciita UTSW 16 10512288 missense probably damaging 1.00
R8314:Ciita UTSW 16 10510988 missense probably damaging 0.99
R8772:Ciita UTSW 16 10480162 missense probably damaging 1.00
RF019:Ciita UTSW 16 10506747 missense probably damaging 0.98
Z1176:Ciita UTSW 16 10508700 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACGAGGTCCTTGATTATATCG -3'
(R):5'- ACAACAGGGCTGTGACTATAGC -3'

Sequencing Primer
(F):5'- TTATATCGTGAGGCAGCCAGACC -3'
(R):5'- CAGGGCTGTGACTATAGCTGCAG -3'
Posted On2019-05-13