Incidental Mutation 'R7007:Bbx'
ID544797
Institutional Source Beutler Lab
Gene Symbol Bbx
Ensembl Gene ENSMUSG00000022641
Gene Namebobby sox HMG box containing
Synonyms5730403O13Rik, 5530401J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location50191844-50432390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50202488 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 703 (T703I)
Ref Sequence ENSEMBL: ENSMUSP00000066384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066037] [ENSMUST00000089404] [ENSMUST00000114488] [ENSMUST00000138166]
PDB Structure
Solution Structure of the HMG_box Domain of Murine Bobby Sox Homolog [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066037
AA Change: T703I

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066384
Gene: ENSMUSG00000022641
AA Change: T703I

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
Pfam:DUF2028 109 150 3.1e-22 PFAM
Pfam:DUF2028 140 214 4.4e-26 PFAM
low complexity region 216 230 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 561 566 N/A INTRINSIC
low complexity region 780 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089404
AA Change: T761I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000086826
Gene: ENSMUSG00000022641
AA Change: T761I

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.7e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114488
AA Change: T781I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110132
Gene: ENSMUSG00000022641
AA Change: T781I

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138166
AA Change: T781I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119238
Gene: ENSMUSG00000022641
AA Change: T781I

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 335 9.2e-54 PFAM
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show increased IgA level, abnormal tooth morphology, and a reduction in heart weight, lean body mass, body length, long bone length, bone mineral density, and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Bbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Bbx APN 16 50202513 missense probably benign 0.08
IGL01544:Bbx APN 16 50274777 nonsense probably null
IGL02073:Bbx APN 16 50202491 missense probably damaging 1.00
IGL02302:Bbx APN 16 50224915 missense probably damaging 1.00
IGL02566:Bbx APN 16 50223240 splice site probably benign
IGL02618:Bbx APN 16 50247798 missense probably damaging 1.00
IGL03187:Bbx APN 16 50274563 missense probably damaging 0.96
IGL03215:Bbx APN 16 50202572 missense probably damaging 1.00
IGL03295:Bbx APN 16 50224564 missense probably damaging 1.00
dalton UTSW 16 50210442 splice site probably null
PIT4378001:Bbx UTSW 16 50280473 nonsense probably null
R0024:Bbx UTSW 16 50224918 missense probably benign
R0024:Bbx UTSW 16 50224918 missense probably benign
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0143:Bbx UTSW 16 50280392 missense probably benign 0.32
R0144:Bbx UTSW 16 50280392 missense probably benign 0.32
R0374:Bbx UTSW 16 50280392 missense probably benign 0.32
R0532:Bbx UTSW 16 50266284 missense probably damaging 1.00
R0550:Bbx UTSW 16 50274533 splice site probably benign
R0762:Bbx UTSW 16 50225166 missense possibly damaging 0.94
R0881:Bbx UTSW 16 50220600 splice site probably benign
R1448:Bbx UTSW 16 50266270 nonsense probably null
R1916:Bbx UTSW 16 50266245 missense probably damaging 1.00
R1983:Bbx UTSW 16 50209117 missense possibly damaging 0.62
R2006:Bbx UTSW 16 50224395 missense possibly damaging 0.93
R2095:Bbx UTSW 16 50224689 missense possibly damaging 0.88
R2145:Bbx UTSW 16 50274544 splice site probably benign
R2475:Bbx UTSW 16 50220519 missense probably damaging 0.99
R2892:Bbx UTSW 16 50224741 missense probably damaging 1.00
R4130:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4177:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4486:Bbx UTSW 16 50200414 missense probably damaging 1.00
R4989:Bbx UTSW 16 50224738 missense probably damaging 1.00
R5005:Bbx UTSW 16 50266351 missense probably damaging 1.00
R5427:Bbx UTSW 16 50280497 missense probably benign
R5582:Bbx UTSW 16 50223356 missense probably damaging 1.00
R6063:Bbx UTSW 16 50251367 missense probably benign
R6216:Bbx UTSW 16 50251388 missense probably benign 0.00
R6246:Bbx UTSW 16 50224660 missense probably benign 0.04
R6618:Bbx UTSW 16 50266263 missense probably damaging 1.00
R6782:Bbx UTSW 16 50200565 missense probably benign 0.00
R7130:Bbx UTSW 16 50210442 splice site probably null
R7864:Bbx UTSW 16 50262434 missense probably damaging 0.99
R7947:Bbx UTSW 16 50262434 missense probably damaging 0.99
X0021:Bbx UTSW 16 50247805 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACACCAGGTCTTTATTGAGAAGC -3'
(R):5'- GGTCAGGCATACAGAAACATGTC -3'

Sequencing Primer
(F):5'- ATAGTCATTTGGAGGCCAGC -3'
(R):5'- CAGAAACATGTCTTTTCCAGGATGG -3'
Posted On2019-05-13