Incidental Mutation 'R7007:Npc1'
ID544802
Institutional Source Beutler Lab
Gene Symbol Npc1
Ensembl Gene ENSMUSG00000024413
Gene NameNPC intracellular cholesterol transporter 1
Synonymsnmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location12189693-12236400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12210548 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 463 (T463A)
Ref Sequence ENSEMBL: ENSMUSP00000025279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025279]
Predicted Effect probably benign
Transcript: ENSMUST00000025279
AA Change: T463A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: T463A

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Npc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Npc1 APN 18 12199634 missense probably benign 0.45
IGL02523:Npc1 APN 18 12201572 missense probably benign 0.00
IGL03018:Npc1 APN 18 12214379 missense probably damaging 0.99
IGL03101:Npc1 APN 18 12198539 missense probably benign 0.15
IGL03151:Npc1 APN 18 12219275 missense probably benign 0.05
IGL03377:Npc1 APN 18 12211821 missense probably benign
PIT4354001:Npc1 UTSW 18 12211535 missense probably benign 0.00
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0190:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R0200:Npc1 UTSW 18 12219204 missense probably damaging 1.00
R0485:Npc1 UTSW 18 12213446 missense probably benign 0.00
R0699:Npc1 UTSW 18 12210575 missense probably benign 0.00
R0730:Npc1 UTSW 18 12219325 missense probably benign 0.00
R1302:Npc1 UTSW 18 12195085 missense probably benign 0.00
R1442:Npc1 UTSW 18 12195049 missense probably benign
R1463:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R1804:Npc1 UTSW 18 12223088 missense probably damaging 1.00
R1808:Npc1 UTSW 18 12194092 missense probably damaging 1.00
R1928:Npc1 UTSW 18 12213378 missense possibly damaging 0.79
R2112:Npc1 UTSW 18 12213472 missense possibly damaging 0.49
R2117:Npc1 UTSW 18 12196556 missense probably damaging 1.00
R2157:Npc1 UTSW 18 12191809 missense probably damaging 0.98
R2279:Npc1 UTSW 18 12197179 splice site probably null
R2311:Npc1 UTSW 18 12202183 missense probably benign
R2446:Npc1 UTSW 18 12214339 missense probably benign 0.01
R3004:Npc1 UTSW 18 12197254 missense probably benign 0.03
R4090:Npc1 UTSW 18 12198162 splice site probably null
R4304:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4308:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4564:Npc1 UTSW 18 12191732 missense probably damaging 1.00
R4786:Npc1 UTSW 18 12199497 missense probably benign 0.35
R5243:Npc1 UTSW 18 12198631 intron probably benign
R5404:Npc1 UTSW 18 12213299 missense possibly damaging 0.79
R5823:Npc1 UTSW 18 12191789 missense possibly damaging 0.69
R6080:Npc1 UTSW 18 12219351 missense probably damaging 1.00
R6215:Npc1 UTSW 18 12236192 small deletion probably benign
R6301:Npc1 UTSW 18 12197245 missense probably benign 0.00
R6476:Npc1 UTSW 18 12201694 nonsense probably null
R7020:Npc1 UTSW 18 12198537 missense probably damaging 1.00
R7048:Npc1 UTSW 18 12204765 splice site probably null
R7116:Npc1 UTSW 18 12211544 missense probably damaging 1.00
R7153:Npc1 UTSW 18 12213291 missense possibly damaging 0.78
R7359:Npc1 UTSW 18 12195180 missense probably benign 0.05
R7382:Npc1 UTSW 18 12201706 missense probably damaging 0.99
R7765:Npc1 UTSW 18 12195048 missense probably benign 0.01
R8047:Npc1 UTSW 18 12213317 missense probably benign 0.00
R8094:Npc1 UTSW 18 12194240 missense probably benign
X0012:Npc1 UTSW 18 12193311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACATCTGGTTCCATCTACTGGGTC -3'
(R):5'- AAGTATGCCCTCCGAGCATC -3'

Sequencing Primer
(F):5'- CATCTACTGGGTCTCCATATGTATG -3'
(R):5'- GAGCATCCTTCTCGCCCG -3'
Posted On2019-05-13