Mutagenetix > Incidental Mutation

Incidental Mutation 'R7007:Sptbn2'

544803

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7007 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4711208-4752353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4744145 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1459 (V1459E)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]

AlphaFold

Q68FG2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000008991
AA Change: V1459E

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: V1459E

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178353

SMART Domains

Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

Domain	Start	End	E-Value	Type
RRM	2	69	1.96e-17	SMART
Pfam:RRM_1	81	118	5.6e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	C	T	14: 36,095,164	T57I	probably benign	Het
Adcy8	T	C	15: 64,704,716	N999S	possibly damaging	Het
Adgrv1	T	A	13: 81,536,364	I1073F	possibly damaging	Het
Akap3	A	G	6: 126,866,476	D686G	probably damaging	Het
Alg2	A	T	4: 47,471,881	I309N	probably benign	Het
Ankrd36	A	G	11: 5,689,168	E1360G	probably benign	Het
Aox2	C	A	1: 58,330,892	Q788K	probably damaging	Het
Apoc2	A	T	7: 19,673,357	D26E	possibly damaging	Het
Bbx	G	A	16: 50,202,488	T703I	possibly damaging	Het
C2cd4d	T	C	3: 94,364,071	Y215H	probably benign	Het
C3	C	T	17: 57,218,809	E858K	probably benign	Het
Ciita	T	C	16: 10,511,307	L482P	probably damaging	Het
Cldn9	T	C	17: 23,683,078	E191G	probably benign	Het
Cnst	T	A	1: 179,610,568	S566T	probably damaging	Het
Col5a2	A	G	1: 45,378,449	I1322T	possibly damaging	Het
Cp	G	A	3: 19,969,973	V326M	probably damaging	Het
Cyp7b1	G	A	3: 18,097,618	Q144*	probably null	Het
Dnah10	T	C	5: 124,787,426	S2232P	probably damaging	Het
Dnah17	T	C	11: 118,118,871	E625G	possibly damaging	Het
Dnah7c	T	A	1: 46,532,750	D794E	probably benign	Het
Dusp10	G	A	1: 184,037,217	V127M	probably benign	Het
Dysf	G	C	6: 84,113,980	W1015C	probably damaging	Het
Fbxw17	T	C	13: 50,423,772	Y104H	probably damaging	Het
Gm6408	G	A	5: 146,483,837	E176K	probably damaging	Het
Gp1bb	T	A	16: 18,620,939	D135V	possibly damaging	Het
Gprin1	C	T	13: 54,738,256	C735Y	probably damaging	Het
Heatr9	T	A	11: 83,520,620	M30L	possibly damaging	Het
Hhat	G	A	1: 192,693,826	T333I	possibly damaging	Het
Htr5b	A	G	1: 121,510,494	F336S	probably damaging	Het
Ippk	T	G	13: 49,436,705		probably null	Het
Jph1	T	A	1: 17,004,186	H11L	possibly damaging	Het
Kif12	T	A	4: 63,166,480	I534L	probably benign	Het
Lemd3	A	T	10: 120,952,232	F523I	probably benign	Het
Lgsn	C	A	1: 31,190,427	H76Q	probably benign	Het
Lipm	T	A	19: 34,112,097	W152R	probably damaging	Het
Mei1	A	T	15: 82,093,999	R216W	probably damaging	Het
Mybpc1	C	T	10: 88,553,412	G379S	probably damaging	Het
Myh8	A	G	11: 67,288,316	T512A	probably benign	Het
Nf1	A	G	11: 79,447,023		probably null	Het
Npc1	T	C	18: 12,210,548	T463A	probably benign	Het
Olfr1145	A	G	2: 87,809,886	N22S	probably damaging	Het
Olfr1383	G	A	11: 49,524,184	V154M	probably benign	Het
Olfr789	A	T	10: 129,487,408	I133F	probably damaging	Het
Osbpl11	T	G	16: 33,226,939	I424R	possibly damaging	Het
Pnmal2	A	T	7: 16,946,256	K388N	possibly damaging	Het
Ppp1r26	A	T	2: 28,451,159	K267I	probably damaging	Het
Psmb5	A	T	14: 54,616,709	M104K	probably damaging	Het
Ptges2	T	C	2: 32,402,306	V378A	probably benign	Het
Rcan2	C	T	17: 43,836,325	S18F	probably benign	Het
Sf3b2	C	T	19: 5,274,517	R859Q	probably benign	Het
Slc7a1	G	A	5: 148,352,446			Het
Spata31d1a	T	A	13: 59,703,634	T227S	probably benign	Het
Srgap2	T	C	1: 131,319,537	I586V	probably benign	Het
St6galnac1	G	A	11: 116,767,007	R356*	probably null	Het
Taf5	T	A	19: 47,071,211	F265I	probably damaging	Het
Tex45	A	T	8: 3,476,309	D154V	probably damaging	Het
Tkfc	T	A	19: 10,596,363	I229L	probably benign	Het
Tmem132c	T	A	5: 127,359,615	L56Q	probably damaging	Het
Togaram2	C	T	17: 71,709,643	A665V	probably damaging	Het
Ttn	G	A	2: 76,707,046	T34846I	probably benign	Het
Tyr	G	A	7: 87,493,340	A4V	probably benign	Het
Ubap2	A	C	4: 41,206,221	F549L	probably damaging	Het
Usp2	T	C	9: 44,090,042	S294P	probably damaging	Het
Vrk3	A	G	7: 44,757,763	N53D	probably damaging	Het
Zfp324	T	C	7: 12,971,215	S444P	probably damaging	Het
Zfp597	T	C	16: 3,865,927	I322V	probably benign	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4724705	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4725938	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01373:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01420:Sptbn2	APN	19	4734125	missense	probably benign
IGL01456:Sptbn2	APN	19	4746749	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4749693	missense	probably benign
IGL03026:Sptbn2	APN	19	4724233	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4732661	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4747832	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4745577	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0121:Sptbn2	UTSW	19	4745293	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4724744	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4746942	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4745145	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4737926	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4745938	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4726690	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4739986	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4748123	nonsense	probably null
R0742:Sptbn2	UTSW	19	4718983	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4732665	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4718976	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4744246	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4750242	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4750497	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4745964	nonsense	probably null
R1820:Sptbn2	UTSW	19	4726596	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4732541	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4732685	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4745299	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4738559	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4734138	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4718935	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4748636	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4745922	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4738355	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4732602	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4739239	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4732496	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4742480	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4748154	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4729430	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4738469	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4729309	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4729202	splice site	probably null
R4981:Sptbn2	UTSW	19	4751658	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4737857	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4724184	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4750082	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4718908	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4750105	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4725950	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4748947	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4724667	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4738219	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4739278	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4731392	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4748138	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4724646	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4732496	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4742418	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4744180	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4747926	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4749814	missense	probably benign
R6703:Sptbn2	UTSW	19	4749815	missense	probably benign
R6753:Sptbn2	UTSW	19	4747785	missense	probably benign	0.01
R7131:Sptbn2	UTSW	19	4749460	missense	probably null
R7219:Sptbn2	UTSW	19	4724173	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4737443	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4751574	missense	probably benign
R7469:Sptbn2	UTSW	19	4745118	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4748082	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4726168	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4744207	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4724125	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4734143	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4744262	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4746799	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4737403	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4729130	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4746696	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4734213	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4739946	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4738190	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4745313	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4738205	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4745191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATCATGGCTGGTTTGATACAGG -3'
(R):5'- TGCAGGACATCCATGAACATC -3'

Sequencing Primer
(F):5'- ACAGGCTTATGTCTTAGGAGTTGAAG -3'
(R):5'- ATCCCAGTGCCCAGGAAGTG -3'

Posted On

2019-05-13