Incidental Mutation 'R7007:Lipm'
ID544806
Institutional Source Beutler Lab
Gene Symbol Lipm
Ensembl Gene ENSMUSG00000056078
Gene Namelipase, family member M
SynonymsLipl3, 4632427C23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34100943-34122687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34112097 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 152 (W152R)
Ref Sequence ENSEMBL: ENSMUSP00000025685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025685]
Predicted Effect probably damaging
Transcript: ENSMUST00000025685
AA Change: W152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025685
Gene: ENSMUSG00000056078
AA Change: W152R

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 49 111 3.3e-26 PFAM
Pfam:Abhydrolase_1 92 393 2.6e-29 PFAM
Pfam:Abhydrolase_5 93 387 2.5e-10 PFAM
Meta Mutation Damage Score 0.7217 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Lipm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Lipm APN 19 34121145 missense probably damaging 1.00
IGL01789:Lipm APN 19 34118747 missense probably damaging 1.00
IGL01878:Lipm APN 19 34116511 missense possibly damaging 0.63
IGL01897:Lipm APN 19 34121308 missense probably damaging 1.00
IGL02713:Lipm APN 19 34101170 start codon destroyed probably null 0.77
R0029:Lipm UTSW 19 34116548 splice site probably benign
R0352:Lipm UTSW 19 34112875 splice site probably benign
R0565:Lipm UTSW 19 34116506 missense probably benign 0.00
R0815:Lipm UTSW 19 34118761 missense probably benign 0.13
R1658:Lipm UTSW 19 34116447 missense probably benign
R2990:Lipm UTSW 19 34116486 missense probably benign 0.03
R4758:Lipm UTSW 19 34101170 start codon destroyed possibly damaging 0.59
R5446:Lipm UTSW 19 34117887 missense possibly damaging 0.92
R5468:Lipm UTSW 19 34109554 splice site probably null
R5905:Lipm UTSW 19 34111911 missense probably benign
R6066:Lipm UTSW 19 34112974 missense probably damaging 1.00
R6437:Lipm UTSW 19 34121257 missense probably damaging 1.00
R6722:Lipm UTSW 19 34121265 missense probably benign 0.00
R6927:Lipm UTSW 19 34101163 start gained probably benign
R7031:Lipm UTSW 19 34116471 missense probably benign
R7081:Lipm UTSW 19 34121323 missense possibly damaging 0.90
R7092:Lipm UTSW 19 34121358 missense possibly damaging 0.75
R7419:Lipm UTSW 19 34116481 missense probably benign 0.09
R7426:Lipm UTSW 19 34116198 missense possibly damaging 0.56
R7772:Lipm UTSW 19 34117891 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTGTTTGCAGGATCCAGGC -3'
(R):5'- ACCCACTAGCTAGACCTTGG -3'

Sequencing Primer
(F):5'- GCCAGTGGTGTTACTGCAAC -3'
(R):5'- TAGACCTTGGGAGACACAGTCTTC -3'
Posted On2019-05-13