Mutagenetix > Incidental Mutation

Incidental Mutation 'R7008:Arhgef11'

544813

Institutional Source

Beutler Lab

Gene Symbol

Arhgef11

Ensembl Gene

ENSMUSG00000041977

Gene Name

Rho guanine nucleotide exchange factor (GEF) 11

Synonyms

Prg, PDZ-RhoGEF

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7008 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87617559-87738034 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 87729218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 992 (T992K)

Ref Sequence

ENSEMBL: ENSMUSP00000039900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]

AlphaFold

Q68FM7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039476
AA Change: T992K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: T992K

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC
low complexity region	625	639	N/A	INTRINSIC
low complexity region	681	694	N/A	INTRINSIC
RhoGEF	768	952	1.11e-65	SMART
PH	996	1111	9.49e-6	SMART
low complexity region	1153	1166	N/A	INTRINSIC
low complexity region	1176	1188	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1357	1367	N/A	INTRINSIC
low complexity region	1478	1490	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129113
AA Change: T963K

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: T963K

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
RGS	313	432	3.36e-11	SMART
low complexity region	596	610	N/A	INTRINSIC
low complexity region	652	665	N/A	INTRINSIC
RhoGEF	739	923	1.11e-65	SMART
PH	967	1082	9.49e-6	SMART
low complexity region	1124	1137	N/A	INTRINSIC
low complexity region	1147	1159	N/A	INTRINSIC
low complexity region	1304	1314	N/A	INTRINSIC
low complexity region	1328	1338	N/A	INTRINSIC
low complexity region	1449	1461	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152006

SMART Domains

Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	T	A	5: 90,260,096	I1421F	possibly damaging	Het
Arid1b	T	C	17: 5,290,979	Y853H	probably damaging	Het
Bcl10	G	T	3: 145,933,299	R232L	probably benign	Het
Best2	T	A	8: 85,013,211	I76F	possibly damaging	Het
Card11	G	C	5: 140,873,393	R1133G	probably damaging	Het
Card9	T	C	2: 26,357,799	D180G	possibly damaging	Het
Ccdc162	T	A	10: 41,552,415	E119V	probably damaging	Het
Cd2bp2	T	C	7: 127,195,395	D15G	possibly damaging	Het
Cdk7	A	C	13: 100,717,621	M120R	probably damaging	Het
Cryba4	T	A	5: 112,251,782	T2S	probably benign	Het
Cyp19a1	A	T	9: 54,193,325	M26K	probably benign	Het
Dgcr2	A	G	16: 17,845,001	S157P	probably damaging	Het
Dis3l	A	G	9: 64,310,453	F782S	possibly damaging	Het
Ephb4	T	A	5: 137,361,274	S369T	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Gm8251	T	C	1: 44,059,625	D771G	probably benign	Het
Hist1h1e	T	C	13: 23,622,209	K97E	probably damaging	Het
Igf2bp2	A	T	16: 22,081,832	D118E	probably benign	Het
Iqgap3	GGAGAG	GGAG	3: 88,112,771		probably null	Het
Klhl5	T	C	5: 65,143,249	S52P	probably benign	Het
Lrrc28	A	T	7: 67,595,711		probably benign	Het
Map4k4	T	G	1: 39,988,971	D317E	probably benign	Het
Maz	A	T	7: 127,024,612	C66S	probably damaging	Het
Mbd4	T	C	6: 115,850,724	T43A	possibly damaging	Het
Milr1	T	A	11: 106,751,314	S11T	probably damaging	Het
Mthfd2l	T	A	5: 90,959,728	C150S	probably damaging	Het
Nemf	A	T	12: 69,341,621	N325K	possibly damaging	Het
Nemf	C	T	12: 69,353,793		probably null	Het
Nod2	T	A	8: 88,663,657	C197*	probably null	Het
Odf2l	A	G	3: 145,132,734	K241E	probably damaging	Het
Olfr1427	G	A	19: 12,098,850	T263I	possibly damaging	Het
Olfr1489	A	T	19: 13,633,621	N170I	probably damaging	Het
Osbpl10	T	G	9: 115,061,848	D101E	probably damaging	Het
Osgin1	T	C	8: 119,441,494	V20A	possibly damaging	Het
Pan3	T	A	5: 147,545,693	C438S	probably damaging	Het
Plaa	A	G	4: 94,569,349	*795Q	probably null	Het
Prss35	T	C	9: 86,756,308	V377A	probably benign	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rasl12	G	A	9: 65,410,869	V172M	probably damaging	Het
Rdh16f1	A	G	10: 127,790,906	H276R	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Sez6l	T	C	5: 112,464,695	Y460C	probably damaging	Het
Sipa1l1	T	G	12: 82,363,112	M600R	probably damaging	Het
Slc11a2	T	C	15: 100,409,324	Y92C	probably damaging	Het
Slc4a10	A	G	2: 62,286,922	T712A	probably benign	Het
Sntb1	A	T	15: 55,792,072	Y249*	probably null	Het
Spatc1	A	G	15: 76,283,723	I127M	probably benign	Het
Synj1	A	T	16: 90,993,945	N109K	probably damaging	Het
Tdg	T	A	10: 82,648,641	M396K	possibly damaging	Het
Tmem173	C	A	18: 35,735,171	R292L	probably damaging	Het
Tmem252	T	C	19: 24,674,292	V75A	probably damaging	Het
Trim40	T	C	17: 36,883,976	Q142R	probably damaging	Het
Trip6	T	C	5: 137,312,966	T163A	probably damaging	Het
Ttn	T	C	2: 76,894,642		probably benign	Het
Wdr95	T	C	5: 149,611,540	L721P	probably benign	Het
Zfp385c	A	T	11: 100,630,687	D182E	probably damaging	Het
Zfp597	A	G	16: 3,865,767	F375S	probably benign	Het
Zfp658	T	G	7: 43,573,912	F537C	possibly damaging	Het
Zgrf1	T	C	3: 127,561,772	F216L	probably benign	Het

Other mutations in Arhgef11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Arhgef11	APN	3	87729503	missense	probably damaging	1.00
IGL00900:Arhgef11	APN	3	87683560	missense	possibly damaging	0.71
IGL01291:Arhgef11	APN	3	87733174	missense	probably benign	0.00
IGL01475:Arhgef11	APN	3	87727126	splice site	probably benign
IGL01599:Arhgef11	APN	3	87737046	missense	probably benign
IGL02251:Arhgef11	APN	3	87683547	missense	probably damaging	1.00
IGL02651:Arhgef11	APN	3	87698864	missense	probably damaging	0.99
IGL02884:Arhgef11	APN	3	87728006	missense	probably damaging	1.00
IGL02900:Arhgef11	APN	3	87733160	missense	probably benign	0.07
IGL03017:Arhgef11	APN	3	87717060	nonsense	probably null
ANU05:Arhgef11	UTSW	3	87733174	missense	probably benign	0.00
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0129:Arhgef11	UTSW	3	87728063	missense	probably damaging	1.00
R0486:Arhgef11	UTSW	3	87688852	splice site	probably null
R0698:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0701:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0849:Arhgef11	UTSW	3	87735896	missense	probably benign	0.24
R1055:Arhgef11	UTSW	3	87717118	missense	probably benign	0.19
R1256:Arhgef11	UTSW	3	87727135	missense	possibly damaging	0.81
R1401:Arhgef11	UTSW	3	87733469	nonsense	probably null
R1543:Arhgef11	UTSW	3	87713017	missense	probably benign	0.10
R1547:Arhgef11	UTSW	3	87695402	missense	possibly damaging	0.87
R1564:Arhgef11	UTSW	3	87702510	missense	probably benign
R1675:Arhgef11	UTSW	3	87731211	missense	possibly damaging	0.84
R2082:Arhgef11	UTSW	3	87725996	missense	possibly damaging	0.47
R2293:Arhgef11	UTSW	3	87727990	missense	probably damaging	1.00
R4739:Arhgef11	UTSW	3	87697999	missense	possibly damaging	0.47
R4930:Arhgef11	UTSW	3	87728594	missense	probably damaging	1.00
R5130:Arhgef11	UTSW	3	87726014	missense	possibly damaging	0.71
R5151:Arhgef11	UTSW	3	87735360	missense	probably damaging	1.00
R5157:Arhgef11	UTSW	3	87728510	splice site	probably null
R5203:Arhgef11	UTSW	3	87735357	missense	probably damaging	1.00
R5329:Arhgef11	UTSW	3	87679752	intron	probably benign
R5615:Arhgef11	UTSW	3	87722485	critical splice donor site	probably null
R5646:Arhgef11	UTSW	3	87684486	missense	possibly damaging	0.94
R6125:Arhgef11	UTSW	3	87729602	missense	probably damaging	1.00
R6242:Arhgef11	UTSW	3	87728078	missense	probably benign
R6543:Arhgef11	UTSW	3	87733408	missense	probably benign	0.09
R6801:Arhgef11	UTSW	3	87735852	missense	possibly damaging	0.53
R6939:Arhgef11	UTSW	3	87686920	missense	probably damaging	1.00
R7155:Arhgef11	UTSW	3	87709572	nonsense	probably null
R7169:Arhgef11	UTSW	3	87727448	missense	possibly damaging	0.79
R7325:Arhgef11	UTSW	3	87713292	missense	possibly damaging	0.62
R7392:Arhgef11	UTSW	3	87717175	critical splice donor site	probably null
R7683:Arhgef11	UTSW	3	87722383	missense	probably damaging	0.98
R7875:Arhgef11	UTSW	3	87684501	missense	probably damaging	1.00
R7912:Arhgef11	UTSW	3	87733222	missense	probably damaging	1.00
R7980:Arhgef11	UTSW	3	87697990	missense	probably benign	0.01
R8028:Arhgef11	UTSW	3	87735552	missense	probably benign
R8081:Arhgef11	UTSW	3	87725642	missense	probably damaging	1.00
R8118:Arhgef11	UTSW	3	87735857	missense	probably damaging	1.00
R8207:Arhgef11	UTSW	3	87698775	missense	possibly damaging	0.71
R8290:Arhgef11	UTSW	3	87725968	missense	probably damaging	1.00
R8443:Arhgef11	UTSW	3	87713099	missense	probably benign	0.17
R8543:Arhgef11	UTSW	3	87681874	missense	probably damaging	1.00
R8808:Arhgef11	UTSW	3	87686029	missense	probably damaging	1.00
R8969:Arhgef11	UTSW	3	87725642	missense	probably damaging	1.00
R8976:Arhgef11	UTSW	3	87728014	missense	probably benign
R8983:Arhgef11	UTSW	3	87733201	missense
R8987:Arhgef11	UTSW	3	87730481	missense	probably damaging	1.00
R9168:Arhgef11	UTSW	3	87726483	missense	probably damaging	1.00
R9498:Arhgef11	UTSW	3	87733177	missense	probably benign
R9741:Arhgef11	UTSW	3	87687849	missense	probably benign	0.03
X0011:Arhgef11	UTSW	3	87722406	missense	probably benign
Z1176:Arhgef11	UTSW	3	87735462	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGCACGTCTCCATTGGTATATCC -3'
(R):5'- TCAAGGAGTCCTACGCTGAC -3'

Sequencing Primer
(F):5'- ATTGGTATATCCCCCAGAGCATC -3'
(R):5'- AGGAGTCCTACGCTGACATTCTAG -3'

Posted On

2019-05-13