Incidental Mutation 'R7008:Fhad1'
ID544819
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7008 (G1)
Quality Score206.468
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 141918291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably null
Transcript: ENSMUST00000036701
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105779
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105780
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTCCACCAAGTCTGTGTG -3'
(R):5'- TATTTAAAGGCCGCCTGTCCC -3'

Sequencing Primer
(F):5'- CAAGTCTGTGTGTTCCCCTGG -3'
(R):5'- TCCCTGGGCATTTTGAGC -3'
Posted On2019-05-13