Incidental Mutation 'R7008:Sez6l'
ID544824
Institutional Source Beutler Lab
Gene Symbol Sez6l
Ensembl Gene ENSMUSG00000058153
Gene Nameseizure related 6 homolog like
SynonymsAcig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7008 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location112419151-112577185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112464695 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 460 (Y460C)
Ref Sequence ENSEMBL: ENSMUSP00000148806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075387] [ENSMUST00000079491] [ENSMUST00000197425] [ENSMUST00000212480] [ENSMUST00000212758]
Predicted Effect probably damaging
Transcript: ENSMUST00000075387
AA Change: Y460C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074847
Gene: ENSMUSG00000058153
AA Change: Y460C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 880 891 N/A INTRINSIC
transmembrane domain 895 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079491
AA Change: Y460C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078454
Gene: ENSMUSG00000058153
AA Change: Y460C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 878 892 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197425
AA Change: Y460C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143395
Gene: ENSMUSG00000058153
AA Change: Y460C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
low complexity region 815 826 N/A INTRINSIC
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000212480
AA Change: Y460C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212758
AA Change: Y460C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display slightly impaired coordination in the rotarod task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Sez6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Sez6l APN 5 112424645 missense probably damaging 1.00
IGL00494:Sez6l APN 5 112463003 missense probably damaging 1.00
IGL00693:Sez6l APN 5 112422013 missense probably damaging 1.00
IGL01146:Sez6l APN 5 112428409 missense probably damaging 1.00
IGL01382:Sez6l APN 5 112425621 missense probably benign 0.00
IGL01393:Sez6l APN 5 112438395 splice site probably benign
IGL01961:Sez6l APN 5 112471731 missense probably damaging 1.00
IGL02101:Sez6l APN 5 112472746 missense probably damaging 1.00
IGL02104:Sez6l APN 5 112426764 intron probably benign
IGL02316:Sez6l APN 5 112462962 missense probably damaging 1.00
IGL02965:Sez6l APN 5 112475574 missense probably damaging 0.99
IGL03102:Sez6l APN 5 112475403 missense probably benign 0.02
IGL03112:Sez6l APN 5 112473467 missense probably damaging 1.00
IGL03180:Sez6l APN 5 112436285 missense probably damaging 1.00
ranger UTSW 5 112576812 splice site probably null
R0245:Sez6l UTSW 5 112475566 missense probably benign
R0662:Sez6l UTSW 5 112473422 missense probably damaging 1.00
R1227:Sez6l UTSW 5 112473464 missense probably damaging 1.00
R1605:Sez6l UTSW 5 112475049 missense probably damaging 1.00
R1873:Sez6l UTSW 5 112473410 splice site probably benign
R1878:Sez6l UTSW 5 112475223 missense probably damaging 0.98
R1892:Sez6l UTSW 5 112472799 missense probably damaging 1.00
R1961:Sez6l UTSW 5 112424615 splice site probably benign
R2038:Sez6l UTSW 5 112472752 missense possibly damaging 0.81
R2212:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R2315:Sez6l UTSW 5 112464597 missense probably benign 0.02
R2343:Sez6l UTSW 5 112464731 missense probably damaging 1.00
R3412:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3413:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3423:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R3425:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R4081:Sez6l UTSW 5 112461166 missense probably benign 0.01
R4574:Sez6l UTSW 5 112428478 missense probably damaging 1.00
R5792:Sez6l UTSW 5 112422024 nonsense probably null
R5864:Sez6l UTSW 5 112438400 critical splice donor site probably null
R6236:Sez6l UTSW 5 112475244 missense possibly damaging 0.86
R6274:Sez6l UTSW 5 112475365 nonsense probably null
R6466:Sez6l UTSW 5 112461141 splice site probably null
R6574:Sez6l UTSW 5 112576826 missense possibly damaging 0.89
R7241:Sez6l UTSW 5 112473480 missense probably benign
R7329:Sez6l UTSW 5 112440907 missense probably damaging 0.99
R7335:Sez6l UTSW 5 112576812 splice site probably null
R7502:Sez6l UTSW 5 112475481 missense possibly damaging 0.89
R7870:Sez6l UTSW 5 112438581 missense probably damaging 1.00
R8260:Sez6l UTSW 5 112461256 missense probably benign 0.23
X0052:Sez6l UTSW 5 112472901 missense possibly damaging 0.75
Z1088:Sez6l UTSW 5 112440915 missense probably damaging 1.00
Z1177:Sez6l UTSW 5 112576932 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAATCATGGGCCAGTCTGG -3'
(R):5'- AGAGGCAGGATTTGGGTTCC -3'

Sequencing Primer
(F):5'- AGTCTGGGTCCCTCATGCTTAG -3'
(R):5'- TGGGTTCCGAGGGAGAC -3'
Posted On2019-05-13