Incidental Mutation 'R7008:Trip6'
ID544825
Institutional Source Beutler Lab
Gene Symbol Trip6
Ensembl Gene ENSMUSG00000023348
Gene Namethyroid hormone receptor interactor 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7008 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137309654-137314404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137312966 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 163 (T163A)
Ref Sequence ENSEMBL: ENSMUSP00000024119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024119] [ENSMUST00000039991] [ENSMUST00000199121]
Predicted Effect probably damaging
Transcript: ENSMUST00000024119
AA Change: T163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024119
Gene: ENSMUSG00000023348
AA Change: T163A

DomainStartEndE-ValueType
low complexity region 155 171 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 239 262 N/A INTRINSIC
LIM 282 335 4.59e-14 SMART
LIM 342 394 1.41e-14 SMART
LIM 402 464 5.65e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039991
SMART Domains Protein: ENSMUSP00000038106
Gene: ENSMUSG00000037344

DomainStartEndE-ValueType
Pfam:AA_permease 42 536 1.8e-114 PFAM
Pfam:SLC12 545 639 4.6e-13 PFAM
low complexity region 804 817 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199121
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the zyxin family and encodes a protein with three LIM zinc-binding domains. This protein localizes to focal adhesion sites and along actin stress fibers. Recruitment of this protein to the plasma membrane occurs in a lysophosphatidic acid (LPA)-dependent manner and it regulates LPA-induced cell migration. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Trip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Trip6 APN 5 137313413 missense probably benign 0.02
IGL02330:Trip6 APN 5 137313358 missense probably benign 0.01
IGL02471:Trip6 APN 5 137310356 missense probably benign 0.45
IGL03171:Trip6 APN 5 137312884 missense probably benign 0.01
R0058:Trip6 UTSW 5 137310845 unclassified probably benign
R0139:Trip6 UTSW 5 137312174 missense probably benign 0.01
R0270:Trip6 UTSW 5 137312841 missense probably benign
R0464:Trip6 UTSW 5 137313681 missense probably damaging 1.00
R0735:Trip6 UTSW 5 137310821 missense probably benign 0.07
R1169:Trip6 UTSW 5 137311920 missense probably benign 0.09
R3917:Trip6 UTSW 5 137313679 missense probably benign 0.40
R4774:Trip6 UTSW 5 137310171 missense probably damaging 1.00
R5177:Trip6 UTSW 5 137312172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATATGTACTCCAGAAGGTC -3'
(R):5'- ACGCATGGATCTTGGGTCTG -3'

Sequencing Primer
(F):5'- GATATGTACTCCAGAAGGTCCCTCC -3'
(R):5'- CATGGATCTTGGGTCTGGCTTTAC -3'
Posted On2019-05-13