Incidental Mutation 'R7008:Ephb4'
ID 544826
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, b2b2412Clo, Myk1, Tyro11
MMRRC Submission 045110-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7008 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137348371-137372784 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137359536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 369 (S369T)
Ref Sequence ENSEMBL: ENSMUSP00000130275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably benign
Transcript: ENSMUST00000061244
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111054
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111055
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144296
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166239
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,407,955 (GRCm39) I1421F possibly damaging Het
Arhgef11 C A 3: 87,636,525 (GRCm39) T992K possibly damaging Het
Arid1b T C 17: 5,341,254 (GRCm39) Y853H probably damaging Het
Bcl10 G T 3: 145,639,054 (GRCm39) R232L probably benign Het
Best2 T A 8: 85,739,840 (GRCm39) I76F possibly damaging Het
Card11 G C 5: 140,859,148 (GRCm39) R1133G probably damaging Het
Card9 T C 2: 26,247,811 (GRCm39) D180G possibly damaging Het
Ccdc162 T A 10: 41,428,411 (GRCm39) E119V probably damaging Het
Ccdc168 T C 1: 44,098,785 (GRCm39) D771G probably benign Het
Cd2bp2 T C 7: 126,794,567 (GRCm39) D15G possibly damaging Het
Cdk7 A C 13: 100,854,129 (GRCm39) M120R probably damaging Het
Cryba4 T A 5: 112,399,648 (GRCm39) T2S probably benign Het
Cyp19a1 A T 9: 54,100,609 (GRCm39) M26K probably benign Het
Dgcr2 A G 16: 17,662,865 (GRCm39) S157P probably damaging Het
Dis3l A G 9: 64,217,735 (GRCm39) F782S possibly damaging Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
H1f4 T C 13: 23,806,192 (GRCm39) K97E probably damaging Het
Igf2bp2 A T 16: 21,900,582 (GRCm39) D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,020,078 (GRCm39) probably null Het
Klhl5 T C 5: 65,300,592 (GRCm39) S52P probably benign Het
Lrrc28 A T 7: 67,245,459 (GRCm39) probably benign Het
Map4k4 T G 1: 40,028,131 (GRCm39) D317E probably benign Het
Maz A T 7: 126,623,784 (GRCm39) C66S probably damaging Het
Mbd4 T C 6: 115,827,685 (GRCm39) T43A possibly damaging Het
Milr1 T A 11: 106,642,140 (GRCm39) S11T probably damaging Het
Mthfd2l T A 5: 91,107,587 (GRCm39) C150S probably damaging Het
Nemf A T 12: 69,388,395 (GRCm39) N325K possibly damaging Het
Nemf C T 12: 69,400,567 (GRCm39) probably null Het
Nod2 T A 8: 89,390,285 (GRCm39) C197* probably null Het
Odf2l A G 3: 144,838,495 (GRCm39) K241E probably damaging Het
Or4z4 G A 19: 12,076,214 (GRCm39) T263I possibly damaging Het
Or5b124 A T 19: 13,610,985 (GRCm39) N170I probably damaging Het
Osbpl10 T G 9: 114,890,916 (GRCm39) D101E probably damaging Het
Osgin1 T C 8: 120,168,233 (GRCm39) V20A possibly damaging Het
Pan3 T A 5: 147,482,503 (GRCm39) C438S probably damaging Het
Plaa A G 4: 94,457,586 (GRCm39) *795Q probably null Het
Prss35 T C 9: 86,638,361 (GRCm39) V377A probably benign Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rasl12 G A 9: 65,318,151 (GRCm39) V172M probably damaging Het
Rdh16f1 A G 10: 127,626,775 (GRCm39) H276R probably benign Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Sez6l T C 5: 112,612,561 (GRCm39) Y460C probably damaging Het
Sipa1l1 T G 12: 82,409,886 (GRCm39) M600R probably damaging Het
Slc11a2 T C 15: 100,307,205 (GRCm39) Y92C probably damaging Het
Slc4a10 A G 2: 62,117,266 (GRCm39) T712A probably benign Het
Sntb1 A T 15: 55,655,468 (GRCm39) Y249* probably null Het
Spatc1 A G 15: 76,167,923 (GRCm39) I127M probably benign Het
Sting1 C A 18: 35,868,224 (GRCm39) R292L probably damaging Het
Synj1 A T 16: 90,790,833 (GRCm39) N109K probably damaging Het
Tdg T A 10: 82,484,475 (GRCm39) M396K possibly damaging Het
Tmem252 T C 19: 24,651,656 (GRCm39) V75A probably damaging Het
Trim40 T C 17: 37,194,868 (GRCm39) Q142R probably damaging Het
Trip6 T C 5: 137,311,228 (GRCm39) T163A probably damaging Het
Ttn T C 2: 76,724,986 (GRCm39) probably benign Het
Wdr95 T C 5: 149,535,005 (GRCm39) L721P probably benign Het
Zfp385c A T 11: 100,521,513 (GRCm39) D182E probably damaging Het
Zfp597 A G 16: 3,683,631 (GRCm39) F375S probably benign Het
Zfp658 T G 7: 43,223,336 (GRCm39) F537C possibly damaging Het
Zgrf1 T C 3: 127,355,421 (GRCm39) F216L probably benign Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137,363,877 (GRCm39) splice site probably benign
IGL00948:Ephb4 APN 5 137,364,921 (GRCm39) missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137,364,003 (GRCm39) splice site probably benign
IGL01885:Ephb4 APN 5 137,356,059 (GRCm39) missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137,359,456 (GRCm39) missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137,369,024 (GRCm39) missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137,370,332 (GRCm39) missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137,352,763 (GRCm39) nonsense probably null
IGL03080:Ephb4 APN 5 137,352,345 (GRCm39) splice site probably benign
IGL03111:Ephb4 APN 5 137,370,767 (GRCm39) missense probably benign 0.07
R0599:Ephb4 UTSW 5 137,368,117 (GRCm39) missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137,363,929 (GRCm39) missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137,364,796 (GRCm39) splice site probably benign
R1441:Ephb4 UTSW 5 137,359,509 (GRCm39) missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137,370,440 (GRCm39) missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137,358,696 (GRCm39) missense probably benign
R1831:Ephb4 UTSW 5 137,352,677 (GRCm39) missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137,361,572 (GRCm39) missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137,352,688 (GRCm39) missense probably benign 0.08
R2206:Ephb4 UTSW 5 137,355,981 (GRCm39) missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137,363,962 (GRCm39) missense probably benign 0.15
R4779:Ephb4 UTSW 5 137,363,964 (GRCm39) missense probably benign 0.04
R4801:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137,361,574 (GRCm39) missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137,359,404 (GRCm39) missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137,368,114 (GRCm39) missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137,352,701 (GRCm39) missense probably benign 0.00
R5662:Ephb4 UTSW 5 137,370,457 (GRCm39) missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137,358,678 (GRCm39) missense probably benign 0.00
R6336:Ephb4 UTSW 5 137,370,347 (GRCm39) missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137,358,711 (GRCm39) missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137,364,849 (GRCm39) missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137,368,066 (GRCm39) missense probably damaging 1.00
R7145:Ephb4 UTSW 5 137,370,308 (GRCm39) missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137,352,687 (GRCm39) missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137,359,560 (GRCm39) missense probably benign
R7635:Ephb4 UTSW 5 137,370,365 (GRCm39) missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137,363,937 (GRCm39) missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137,370,699 (GRCm39) missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137,356,117 (GRCm39) missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137,369,067 (GRCm39) missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137,352,824 (GRCm39) missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137,361,529 (GRCm39) missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137,361,564 (GRCm39) missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137,371,820 (GRCm39) missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137,359,621 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGAAGATTAGTGTGACTGACTGTC -3'
(R):5'- AGTGGTGACATTGACAGGCTC -3'

Sequencing Primer
(F):5'- ACTGACTGTCTGTCCTTTAGGCTAG -3'
(R):5'- TGGTGACATTGACAGGCTCAAAAG -3'
Posted On 2019-05-13