Incidental Mutation 'R7008:Ephb4'
ID544826
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene NameEph receptor B4
SynonymsMDK2, Htk, Myk1, Tyro11
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7008 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137350109-137378669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137361274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 369 (S369T)
Ref Sequence ENSEMBL: ENSMUSP00000130275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
Predicted Effect probably benign
Transcript: ENSMUST00000061244
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111054
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111055
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144296
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166239
AA Change: S369T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: S369T

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0599:Ephb4 UTSW 5 137369855 missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137360416 missense probably benign 0.00
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137366587 missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137357855 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGAAGATTAGTGTGACTGACTGTC -3'
(R):5'- AGTGGTGACATTGACAGGCTC -3'

Sequencing Primer
(F):5'- ACTGACTGTCTGTCCTTTAGGCTAG -3'
(R):5'- TGGTGACATTGACAGGCTCAAAAG -3'
Posted On2019-05-13