Incidental Mutation 'R7008:Dis3l'
ID544839
Institutional Source Beutler Lab
Gene Symbol Dis3l
Ensembl Gene ENSMUSG00000032396
Gene NameDIS3 like exosome 3'-5' exoribonuclease
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R7008 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64306756-64341288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64310453 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 782 (F782S)
Ref Sequence ENSEMBL: ENSMUSP00000129772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068367] [ENSMUST00000113890] [ENSMUST00000120760] [ENSMUST00000168844]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068367
AA Change: F699S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063830
Gene: ENSMUSG00000032396
AA Change: F699S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113890
AA Change: F699S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109522
Gene: ENSMUSG00000032396
AA Change: F699S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120760
AA Change: F699S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113503
Gene: ENSMUSG00000032396
AA Change: F699S

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168844
AA Change: F782S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129772
Gene: ENSMUSG00000032396
AA Change: F782S

DomainStartEndE-ValueType
low complexity region 208 220 N/A INTRINSIC
RNB 465 817 4.82e-127 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic RNA exosome complex degrades unstable mRNAs and is involved in the regular turnover of other mRNAs. The protein encoded by this gene contains 3'-5' exoribonuclease activity and is a catalytic component of this complex. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Dis3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Dis3l APN 9 64319254 critical splice acceptor site probably null
IGL01812:Dis3l APN 9 64310237 missense probably benign 0.00
IGL01838:Dis3l APN 9 64308299 missense probably benign 0.41
IGL02104:Dis3l APN 9 64310329 missense possibly damaging 0.61
IGL02478:Dis3l APN 9 64314773 missense probably benign 0.00
IGL02481:Dis3l APN 9 64319080 splice site probably null
IGL02483:Dis3l APN 9 64319080 splice site probably null
IGL02965:Dis3l APN 9 64310484 missense probably damaging 0.99
IGL03139:Dis3l APN 9 64311950 missense probably damaging 0.99
IGL03054:Dis3l UTSW 9 64310440 critical splice donor site probably null
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0724:Dis3l UTSW 9 64307126 missense possibly damaging 0.92
R0801:Dis3l UTSW 9 64319154 missense probably benign
R0925:Dis3l UTSW 9 64341130 start codon destroyed probably null 0.97
R1502:Dis3l UTSW 9 64325787 missense possibly damaging 0.68
R1541:Dis3l UTSW 9 64307489 missense probably benign 0.07
R1794:Dis3l UTSW 9 64317776 missense possibly damaging 0.67
R1929:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2007:Dis3l UTSW 9 64308276 splice site probably null
R2062:Dis3l UTSW 9 64339573 missense probably benign 0.02
R2152:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2153:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2154:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2186:Dis3l UTSW 9 64339612 nonsense probably null
R2271:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2280:Dis3l UTSW 9 64317794 missense possibly damaging 0.70
R2287:Dis3l UTSW 9 64307497 missense probably benign 0.20
R3156:Dis3l UTSW 9 64311750 missense probably benign 0.25
R4664:Dis3l UTSW 9 64330798 missense unknown
R4775:Dis3l UTSW 9 64330908 missense probably benign 0.16
R4977:Dis3l UTSW 9 64307201 missense probably benign 0.00
R4997:Dis3l UTSW 9 64311942 missense possibly damaging 0.76
R5097:Dis3l UTSW 9 64319216 missense probably damaging 1.00
R5579:Dis3l UTSW 9 64330835 missense probably benign 0.44
R5623:Dis3l UTSW 9 64307603 missense possibly damaging 0.70
R6310:Dis3l UTSW 9 64322575 missense probably benign 0.00
R6442:Dis3l UTSW 9 64307555 missense probably benign
R6505:Dis3l UTSW 9 64307513 missense probably benign 0.15
R6731:Dis3l UTSW 9 64310438 splice site probably null
R7405:Dis3l UTSW 9 64314704 missense probably damaging 1.00
R7555:Dis3l UTSW 9 64311937 nonsense probably null
R7798:Dis3l UTSW 9 64341017 missense probably benign
R7890:Dis3l UTSW 9 64322471 missense probably benign 0.00
R8329:Dis3l UTSW 9 64311830 missense possibly damaging 0.50
X0020:Dis3l UTSW 9 64325734 missense probably damaging 1.00
X0065:Dis3l UTSW 9 64307054 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCCATTAATAGCCGATGTAC -3'
(R):5'- AACCCAGTAGTGTCACTTGTAAATGG -3'

Sequencing Primer
(F):5'- AGCCGATGTACTACAATATCTGAG -3'
(R):5'- ACTTGTAAATGGCCTCTCGGGAC -3'
Posted On2019-05-13