Incidental Mutation 'R7008:Prss35'
ID 544841
Institutional Source Beutler Lab
Gene Symbol Prss35
Ensembl Gene ENSMUSG00000033491
Gene Name protease, serine 35
Synonyms 6030424L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R7008 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 86743649-86758443 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86756308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000137445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036426] [ENSMUST00000179574]
AlphaFold Q8C0F9
Predicted Effect probably benign
Transcript: ENSMUST00000036426
AA Change: V377A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000035271
Gene: ENSMUSG00000033491
AA Change: V377A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179574
AA Change: V377A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000137445
Gene: ENSMUSG00000033491
AA Change: V377A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Prss35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Prss35 APN 9 86755274 missense probably benign 0.00
IGL02749:Prss35 APN 9 86756244 missense probably damaging 1.00
R0346:Prss35 UTSW 9 86755351 missense probably benign 0.04
R0403:Prss35 UTSW 9 86756037 missense probably damaging 1.00
R1664:Prss35 UTSW 9 86755647 missense probably benign 0.29
R2016:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2017:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2325:Prss35 UTSW 9 86756304 missense probably damaging 1.00
R2429:Prss35 UTSW 9 86755345 missense probably benign
R2965:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R2966:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R3961:Prss35 UTSW 9 86755749 missense probably benign 0.02
R4792:Prss35 UTSW 9 86755669 missense probably damaging 1.00
R4902:Prss35 UTSW 9 86756122 missense probably damaging 1.00
R6169:Prss35 UTSW 9 86755438 missense probably benign 0.00
R6446:Prss35 UTSW 9 86755653 missense probably damaging 0.99
R6753:Prss35 UTSW 9 86756100 missense probably damaging 1.00
R7387:Prss35 UTSW 9 86755921 missense probably damaging 1.00
R7523:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7587:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7652:Prss35 UTSW 9 86755970 missense probably benign
R8013:Prss35 UTSW 9 86755425 missense probably damaging 1.00
R8194:Prss35 UTSW 9 86755613 missense possibly damaging 0.94
R8871:Prss35 UTSW 9 86755191 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCTCTGGATTTGACAACGACAG -3'
(R):5'- TGCATAGCTCATGAGTGGTC -3'

Sequencing Primer
(F):5'- CAGGGATGAACAGTTGGTGTATC -3'
(R):5'- CATAGCTCATGAGTGGTCTCTCAATG -3'
Posted On 2019-05-13