Incidental Mutation 'R7008:Osbpl10'
ID544842
Institutional Source Beutler Lab
Gene Symbol Osbpl10
Ensembl Gene ENSMUSG00000040875
Gene Nameoxysterol binding protein-like 10
SynonymsC820004B04Rik, OPR-10, 4933433D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7008 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location114978569-115232225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 115061848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 101 (D101E)
Ref Sequence ENSEMBL: ENSMUSP00000138287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182199] [ENSMUST00000182384] [ENSMUST00000182920] [ENSMUST00000183104] [ENSMUST00000183141]
Predicted Effect probably benign
Transcript: ENSMUST00000182199
SMART Domains Protein: ENSMUSP00000138206
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-19 BLAST
PDB:2D9X|A 1 42 2e-8 PDB
SCOP:d1ki1b2 10 42 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182384
SMART Domains Protein: ENSMUSP00000138552
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-16 BLAST
PDB:2D9X|A 2 46 6e-7 PDB
SCOP:d1ki1b2 10 42 9e-3 SMART
low complexity region 131 152 N/A INTRINSIC
Pfam:Oxysterol_BP 262 626 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182920
Predicted Effect probably damaging
Transcript: ENSMUST00000183104
AA Change: D101E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138287
Gene: ENSMUSG00000040875
AA Change: D101E

DomainStartEndE-ValueType
low complexity region 4 75 N/A INTRINSIC
PH 77 175 2.72e-15 SMART
low complexity region 270 291 N/A INTRINSIC
Pfam:Oxysterol_BP 401 765 1.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183141
SMART Domains Protein: ENSMUSP00000138760
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 3e-18 BLAST
PDB:2D9X|A 2 46 6e-8 PDB
SCOP:d1ki1b2 10 42 9e-4 SMART
low complexity region 131 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp597 A G 16: 3,865,767 F375S probably benign Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Osbpl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Osbpl10 APN 9 115176002 missense probably benign 0.01
IGL01318:Osbpl10 APN 9 115232122 nonsense probably null
IGL02023:Osbpl10 APN 9 115226722 missense probably damaging 1.00
IGL02096:Osbpl10 APN 9 115216994 missense possibly damaging 0.94
R0534:Osbpl10 UTSW 9 115167178 missense probably damaging 1.00
R0948:Osbpl10 UTSW 9 115167119 missense probably damaging 1.00
R1073:Osbpl10 UTSW 9 115207553 nonsense probably null
R2138:Osbpl10 UTSW 9 115232134 missense probably benign 0.06
R3709:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R3710:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R4406:Osbpl10 UTSW 9 115109481 missense probably damaging 0.96
R4738:Osbpl10 UTSW 9 115216574 missense probably damaging 1.00
R4778:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R4779:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R5828:Osbpl10 UTSW 9 115061876 missense probably damaging 0.97
R5874:Osbpl10 UTSW 9 115226760 missense probably damaging 1.00
R6052:Osbpl10 UTSW 9 115067315 splice site probably null
R6103:Osbpl10 UTSW 9 115061872 nonsense probably null
R6174:Osbpl10 UTSW 9 115109487 missense probably benign 0.00
R6246:Osbpl10 UTSW 9 115226774 missense probably benign 0.34
R7027:Osbpl10 UTSW 9 115223698 missense probably damaging 0.97
R7182:Osbpl10 UTSW 9 115067251 missense probably damaging 1.00
R7285:Osbpl10 UTSW 9 115223703 missense probably damaging 1.00
R7556:Osbpl10 UTSW 9 115207624 missense probably damaging 1.00
R7810:Osbpl10 UTSW 9 115061894 missense probably benign 0.01
R7853:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7905:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
R8100:Osbpl10 UTSW 9 115167254 missense probably benign
R8376:Osbpl10 UTSW 9 115223593 missense probably damaging 1.00
R8515:Osbpl10 UTSW 9 115176068 missense probably benign 0.00
R8537:Osbpl10 UTSW 9 115229909 missense probably benign 0.13
R8706:Osbpl10 UTSW 9 115207620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATCCCAGGATCCTCTC -3'
(R):5'- GTATCTCCCCACAGAAGAGC -3'

Sequencing Primer
(F):5'- AGGATCCTCTCTGCTATCACAG -3'
(R):5'- ACAACACTGTGCAGCTGTTG -3'
Posted On2019-05-13