Incidental Mutation 'R7008:Zfp597'
ID 544857
Institutional Source Beutler Lab
Gene Symbol Zfp597
Ensembl Gene ENSMUSG00000039789
Gene Name zinc finger protein 597
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7008 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 3858321-3884561 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3865767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 375 (F375S)
Ref Sequence ENSEMBL: ENSMUSP00000088009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090522]
AlphaFold E9Q6S0
Predicted Effect probably benign
Transcript: ENSMUST00000090522
AA Change: F375S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088009
Gene: ENSMUSG00000039789
AA Change: F375S

DomainStartEndE-ValueType
KRAB 14 75 2.61e-4 SMART
ZnF_C2H2 155 177 5.21e-4 SMART
ZnF_C2H2 183 205 6.88e-4 SMART
ZnF_C2H2 211 233 1.2e-3 SMART
ZnF_C2H2 239 261 2.4e-3 SMART
ZnF_C2H2 336 358 2.17e-1 SMART
ZnF_C2H2 364 386 1.33e-1 SMART
ZnF_C2H2 392 414 2.75e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple zinc finger domains. Loss of the related gene in rodents results in defects in neural development and embryonic lethality in mutant homozygotes. This gene is adjacent to a differentially methylated region (DMR) and is imprinted and maternally expressed. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T A 5: 90,260,096 I1421F possibly damaging Het
Arhgef11 C A 3: 87,729,218 T992K possibly damaging Het
Arid1b T C 17: 5,290,979 Y853H probably damaging Het
Bcl10 G T 3: 145,933,299 R232L probably benign Het
Best2 T A 8: 85,013,211 I76F possibly damaging Het
Card11 G C 5: 140,873,393 R1133G probably damaging Het
Card9 T C 2: 26,357,799 D180G possibly damaging Het
Ccdc162 T A 10: 41,552,415 E119V probably damaging Het
Cd2bp2 T C 7: 127,195,395 D15G possibly damaging Het
Cdk7 A C 13: 100,717,621 M120R probably damaging Het
Cryba4 T A 5: 112,251,782 T2S probably benign Het
Cyp19a1 A T 9: 54,193,325 M26K probably benign Het
Dgcr2 A G 16: 17,845,001 S157P probably damaging Het
Dis3l A G 9: 64,310,453 F782S possibly damaging Het
Ephb4 T A 5: 137,361,274 S369T probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8251 T C 1: 44,059,625 D771G probably benign Het
Hist1h1e T C 13: 23,622,209 K97E probably damaging Het
Igf2bp2 A T 16: 22,081,832 D118E probably benign Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Klhl5 T C 5: 65,143,249 S52P probably benign Het
Lrrc28 A T 7: 67,595,711 probably benign Het
Map4k4 T G 1: 39,988,971 D317E probably benign Het
Maz A T 7: 127,024,612 C66S probably damaging Het
Mbd4 T C 6: 115,850,724 T43A possibly damaging Het
Milr1 T A 11: 106,751,314 S11T probably damaging Het
Mthfd2l T A 5: 90,959,728 C150S probably damaging Het
Nemf A T 12: 69,341,621 N325K possibly damaging Het
Nemf C T 12: 69,353,793 probably null Het
Nod2 T A 8: 88,663,657 C197* probably null Het
Odf2l A G 3: 145,132,734 K241E probably damaging Het
Olfr1427 G A 19: 12,098,850 T263I possibly damaging Het
Olfr1489 A T 19: 13,633,621 N170I probably damaging Het
Osbpl10 T G 9: 115,061,848 D101E probably damaging Het
Osgin1 T C 8: 119,441,494 V20A possibly damaging Het
Pan3 T A 5: 147,545,693 C438S probably damaging Het
Plaa A G 4: 94,569,349 *795Q probably null Het
Prss35 T C 9: 86,756,308 V377A probably benign Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rdh16f1 A G 10: 127,790,906 H276R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sez6l T C 5: 112,464,695 Y460C probably damaging Het
Sipa1l1 T G 12: 82,363,112 M600R probably damaging Het
Slc11a2 T C 15: 100,409,324 Y92C probably damaging Het
Slc4a10 A G 2: 62,286,922 T712A probably benign Het
Sntb1 A T 15: 55,792,072 Y249* probably null Het
Spatc1 A G 15: 76,283,723 I127M probably benign Het
Synj1 A T 16: 90,993,945 N109K probably damaging Het
Tdg T A 10: 82,648,641 M396K possibly damaging Het
Tmem173 C A 18: 35,735,171 R292L probably damaging Het
Tmem252 T C 19: 24,674,292 V75A probably damaging Het
Trim40 T C 17: 36,883,976 Q142R probably damaging Het
Trip6 T C 5: 137,312,966 T163A probably damaging Het
Ttn T C 2: 76,894,642 probably benign Het
Wdr95 T C 5: 149,611,540 L721P probably benign Het
Zfp385c A T 11: 100,630,687 D182E probably damaging Het
Zfp658 T G 7: 43,573,912 F537C possibly damaging Het
Zgrf1 T C 3: 127,561,772 F216L probably benign Het
Other mutations in Zfp597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Zfp597 APN 16 3865941 missense probably benign 0.27
IGL02972:Zfp597 APN 16 3866523 missense probably benign 0.20
IGL03289:Zfp597 APN 16 3865922 missense possibly damaging 0.95
R0336:Zfp597 UTSW 16 3866379 missense probably benign 0.15
R0621:Zfp597 UTSW 16 3866364 missense probably benign 0.01
R4270:Zfp597 UTSW 16 3872090 start codon destroyed probably null 1.00
R4361:Zfp597 UTSW 16 3865900 missense probably damaging 1.00
R4774:Zfp597 UTSW 16 3865987 missense probably benign 0.04
R5033:Zfp597 UTSW 16 3866638 missense probably damaging 1.00
R5128:Zfp597 UTSW 16 3872124 unclassified probably benign
R5786:Zfp597 UTSW 16 3866159 nonsense probably null
R5940:Zfp597 UTSW 16 3865821 missense probably damaging 0.99
R7007:Zfp597 UTSW 16 3865927 missense probably benign 0.25
R7392:Zfp597 UTSW 16 3866505 missense probably benign 0.00
R7963:Zfp597 UTSW 16 3871158 missense probably benign 0.02
R7976:Zfp597 UTSW 16 3866511 missense possibly damaging 0.82
Z1176:Zfp597 UTSW 16 3866129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAGAGCCCAATTCGAGC -3'
(R):5'- GTGTGAAGACCTTGGAGCAG -3'

Sequencing Primer
(F):5'- GAGCCCAATTCGAGCAAAGGC -3'
(R):5'- AAGACCTTGGAGCAGCCCTC -3'
Posted On 2019-05-13