Incidental Mutation 'R7009:Rp1'
ID 544868
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1
MMRRC Submission 045111-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 4185896-4479508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 4112291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1187 (I1187L)
Ref Sequence ENSEMBL: ENSMUSP00000146439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect unknown
Transcript: ENSMUST00000208660
AA Change: I1187L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G T 13: 59,838,624 (GRCm39) D69E possibly damaging Het
Abat A C 16: 8,420,231 (GRCm39) M177L probably benign Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Adam5 T C 8: 25,296,454 (GRCm39) N331S probably benign Het
Ager A G 17: 34,819,710 (GRCm39) E372G probably damaging Het
Angpt1 T A 15: 42,386,991 (GRCm39) Q121L possibly damaging Het
Apoa4 A T 9: 46,154,178 (GRCm39) I260F possibly damaging Het
Arhgap32 A T 9: 32,157,272 (GRCm39) I90F probably damaging Het
Arhgap5 A T 12: 52,566,422 (GRCm39) Q1131L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cacna2d3 A T 14: 28,691,322 (GRCm39) M1K probably null Het
Ccdc18 G A 5: 108,321,728 (GRCm39) probably null Het
Ccdc42 T C 11: 68,485,442 (GRCm39) F267S probably damaging Het
Cdh23 T A 10: 60,173,085 (GRCm39) Y1700F probably damaging Het
Cenpe A T 3: 134,940,962 (GRCm39) S704C probably damaging Het
Cenpe G A 3: 134,940,963 (GRCm39) S704N probably benign Het
Cfap299 A T 5: 98,932,379 (GRCm39) D193V probably damaging Het
Cfap54 A T 10: 92,710,881 (GRCm39) S2727T unknown Het
Clu T A 14: 66,209,281 (GRCm39) V113D probably damaging Het
Cnbd2 A G 2: 156,161,954 (GRCm39) I98V probably benign Het
Copa G T 1: 171,918,567 (GRCm39) R97L probably damaging Het
Epb41l1 C A 2: 156,376,603 (GRCm39) probably null Het
Etnk1 T A 6: 143,148,880 (GRCm39) probably null Het
Fnip1 A T 11: 54,393,761 (GRCm39) K732N probably damaging Het
G6pd2 A G 5: 61,966,234 (GRCm39) E3G probably benign Het
Gal3st2 A G 1: 93,801,481 (GRCm39) T95A probably benign Het
Gapvd1 A G 2: 34,590,829 (GRCm39) S948P probably damaging Het
Ggps1 A T 13: 14,228,750 (GRCm39) Y8* probably null Het
Gria2 T C 3: 80,614,279 (GRCm39) E587G probably damaging Het
Hpse T C 5: 100,840,145 (GRCm39) E324G probably benign Het
Il16 G A 7: 83,295,596 (GRCm39) T493I probably benign Het
Ints1 T C 5: 139,754,217 (GRCm39) T652A possibly damaging Het
Ism1 A G 2: 139,599,199 (GRCm39) I391V probably damaging Het
Katnb1 A G 8: 95,825,012 (GRCm39) D598G probably damaging Het
Kif5c A G 2: 49,647,441 (GRCm39) S880G probably benign Het
Klra8 T C 6: 130,102,147 (GRCm39) N96S probably benign Het
Krt79 T A 15: 101,839,876 (GRCm39) D373V probably damaging Het
Lamtor4 G A 5: 138,257,374 (GRCm39) R92Q probably benign Het
Lce1d C A 3: 92,593,353 (GRCm39) C20F unknown Het
Limk1 T C 5: 134,701,553 (GRCm39) T117A probably benign Het
Medag A T 5: 149,350,708 (GRCm39) K61M probably benign Het
Mkrn3 T C 7: 62,069,366 (GRCm39) M142V probably benign Het
Mob3c G A 4: 115,688,779 (GRCm39) R104H probably benign Het
Morc1 G T 16: 48,447,433 (GRCm39) R903L possibly damaging Het
Myh6 T C 14: 55,189,749 (GRCm39) E1099G probably damaging Het
Nphp3 T G 9: 103,893,315 (GRCm39) C434G probably null Het
Npr3 C T 15: 11,905,334 (GRCm39) C131Y probably damaging Het
Oacyl C A 18: 65,855,609 (GRCm39) Y112* probably null Het
Oprl1 A G 2: 181,360,174 (GRCm39) T77A probably damaging Het
Osgep A G 14: 51,162,165 (GRCm39) V24A probably damaging Het
Otx2 T A 14: 48,896,254 (GRCm39) K260M probably damaging Het
Pdcd11 T C 19: 47,101,581 (GRCm39) L922P probably benign Het
Pgap4 A T 4: 49,586,325 (GRCm39) M281K probably benign Het
Phldb1 A G 9: 44,605,705 (GRCm39) V375A probably damaging Het
Pip5k1b C T 19: 24,337,299 (GRCm39) probably null Het
Psmd3 G A 11: 98,573,592 (GRCm39) D13N probably benign Het
Ptprc G A 1: 137,992,291 (GRCm39) H1140Y probably damaging Het
Ranbp3l A T 15: 9,063,064 (GRCm39) H291L probably damaging Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rilpl1 T A 5: 124,641,755 (GRCm39) silent Het
Rin2 A C 2: 145,725,395 (GRCm39) D794A probably damaging Het
Ripk1 A G 13: 34,214,045 (GRCm39) I522M probably damaging Het
Rnf31 T C 14: 55,830,008 (GRCm39) Y143H probably benign Het
Rps6ka5 G A 12: 100,585,796 (GRCm39) H166Y probably damaging Het
Rrm1 T C 7: 102,109,541 (GRCm39) V455A probably damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn5a T G 9: 119,314,996 (GRCm39) E1904A probably damaging Het
Sec16a G T 2: 26,326,014 (GRCm39) S240* probably null Het
Slc22a8 C T 19: 8,582,781 (GRCm39) T154I probably benign Het
Slc25a16 T A 10: 62,773,233 (GRCm39) V156E possibly damaging Het
Slc28a3 A T 13: 58,758,618 (GRCm39) S2T probably benign Het
Srd5a3 G A 5: 76,297,713 (GRCm39) V48I probably benign Het
Srebf1 A C 11: 60,091,352 (GRCm39) H1025Q probably damaging Het
Stard9 A G 2: 120,527,672 (GRCm39) K1310E probably benign Het
Swt1 A G 1: 151,246,381 (GRCm39) V848A possibly damaging Het
Tanc2 A T 11: 105,731,525 (GRCm39) T434S possibly damaging Het
Tcf20 G A 15: 82,738,883 (GRCm39) T856I probably benign Het
Tcf7l2 T C 19: 55,883,165 (GRCm39) probably null Het
Trim45 A G 3: 100,839,195 (GRCm39) probably benign Het
Tsen2 T A 6: 115,524,933 (GRCm39) M44K possibly damaging Het
Ttc21a T A 9: 119,787,139 (GRCm39) C715* probably null Het
Vmn2r102 G A 17: 19,914,456 (GRCm39) V674I probably damaging Het
Zfp87 A G 13: 67,665,173 (GRCm39) S430P probably damaging Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4,416,969 (GRCm39) missense probably damaging 0.98
IGL00593:Rp1 APN 1 4,415,626 (GRCm39) missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4,422,435 (GRCm39) missense probably damaging 1.00
IGL01070:Rp1 APN 1 4,415,461 (GRCm39) missense probably damaging 1.00
IGL01531:Rp1 APN 1 4,419,168 (GRCm39) missense probably benign 0.00
IGL01668:Rp1 APN 1 4,415,941 (GRCm39) missense probably damaging 1.00
IGL01907:Rp1 APN 1 4,418,730 (GRCm39) missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4,422,745 (GRCm39) missense probably damaging 1.00
IGL02071:Rp1 APN 1 4,415,533 (GRCm39) missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4,417,608 (GRCm39) missense probably damaging 0.99
IGL02244:Rp1 APN 1 4,419,003 (GRCm39) missense probably benign 0.00
IGL02381:Rp1 APN 1 4,422,613 (GRCm39) missense probably benign 0.01
IGL02499:Rp1 APN 1 4,419,271 (GRCm39) missense probably benign 0.17
IGL02619:Rp1 APN 1 4,418,673 (GRCm39) missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4,419,936 (GRCm39) missense probably benign 0.03
IGL02861:Rp1 APN 1 4,416,375 (GRCm39) nonsense probably null
IGL03288:Rp1 APN 1 4,419,747 (GRCm39) missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4,420,264 (GRCm39) missense probably damaging 1.00
IGL03303:Rp1 APN 1 4,415,040 (GRCm39) missense probably damaging 1.00
R0041:Rp1 UTSW 1 4,414,851 (GRCm39) missense probably benign 0.36
R0111:Rp1 UTSW 1 4,414,983 (GRCm39) missense probably damaging 1.00
R0363:Rp1 UTSW 1 4,417,941 (GRCm39) missense probably damaging 1.00
R0440:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R0442:Rp1 UTSW 1 4,416,970 (GRCm39) missense probably benign 0.09
R0528:Rp1 UTSW 1 4,415,088 (GRCm39) missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4,416,721 (GRCm39) missense probably benign 0.00
R0856:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0908:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0968:Rp1 UTSW 1 4,415,575 (GRCm39) missense probably benign 0.00
R1099:Rp1 UTSW 1 4,422,513 (GRCm39) missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4,415,185 (GRCm39) missense probably benign 0.03
R1301:Rp1 UTSW 1 4,416,159 (GRCm39) missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4,418,193 (GRCm39) missense probably benign 0.01
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4,417,619 (GRCm39) missense probably damaging 1.00
R1509:Rp1 UTSW 1 4,418,760 (GRCm39) missense probably benign 0.20
R1509:Rp1 UTSW 1 4,417,917 (GRCm39) missense probably damaging 0.98
R1538:Rp1 UTSW 1 4,415,899 (GRCm39) missense probably damaging 1.00
R1609:Rp1 UTSW 1 4,419,424 (GRCm39) missense probably damaging 1.00
R1666:Rp1 UTSW 1 4,420,086 (GRCm39) missense probably damaging 1.00
R1703:Rp1 UTSW 1 4,415,392 (GRCm39) missense probably damaging 1.00
R1782:Rp1 UTSW 1 4,419,312 (GRCm39) missense probably benign 0.00
R1799:Rp1 UTSW 1 4,419,055 (GRCm39) missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4,417,455 (GRCm39) missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4,418,943 (GRCm39) missense probably damaging 0.99
R1919:Rp1 UTSW 1 4,422,894 (GRCm39) missense probably damaging 0.99
R2087:Rp1 UTSW 1 4,418,575 (GRCm39) missense probably damaging 1.00
R2211:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 0.96
R2278:Rp1 UTSW 1 4,418,250 (GRCm39) missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4,416,182 (GRCm39) nonsense probably null
R2316:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R2346:Rp1 UTSW 1 4,418,236 (GRCm39) missense probably damaging 1.00
R2878:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 1.00
R3023:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3025:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3716:Rp1 UTSW 1 4,419,988 (GRCm39) missense probably benign 0.38
R3814:Rp1 UTSW 1 4,419,931 (GRCm39) missense probably benign
R3929:Rp1 UTSW 1 4,422,868 (GRCm39) missense probably damaging 1.00
R4064:Rp1 UTSW 1 4,415,623 (GRCm39) missense probably benign 0.08
R4426:Rp1 UTSW 1 4,418,147 (GRCm39) missense probably benign 0.13
R4557:Rp1 UTSW 1 4,414,886 (GRCm39) missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4,416,101 (GRCm39) missense probably damaging 0.96
R4845:Rp1 UTSW 1 4,419,451 (GRCm39) missense probably benign 0.02
R4850:Rp1 UTSW 1 4,418,898 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,540 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,539 (GRCm39) missense probably damaging 0.99
R5159:Rp1 UTSW 1 4,416,426 (GRCm39) missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4,418,256 (GRCm39) missense probably benign 0.01
R5327:Rp1 UTSW 1 4,419,583 (GRCm39) splice site probably null
R5352:Rp1 UTSW 1 4,417,321 (GRCm39) missense probably benign 0.00
R5504:Rp1 UTSW 1 4,420,113 (GRCm39) missense probably damaging 1.00
R5527:Rp1 UTSW 1 4,416,616 (GRCm39) missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4,416,055 (GRCm39) missense probably benign 0.42
R5569:Rp1 UTSW 1 4,415,460 (GRCm39) missense probably damaging 1.00
R5622:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4,418,685 (GRCm39) missense probably benign 0.05
R5992:Rp1 UTSW 1 4,218,926 (GRCm39) missense unknown
R6004:Rp1 UTSW 1 4,267,808 (GRCm39) missense unknown
R6018:Rp1 UTSW 1 4,423,059 (GRCm39) missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4,415,602 (GRCm39) missense probably benign 0.02
R6127:Rp1 UTSW 1 4,419,534 (GRCm39) missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4,420,092 (GRCm39) missense probably damaging 1.00
R6301:Rp1 UTSW 1 4,417,477 (GRCm39) missense probably benign 0.04
R6317:Rp1 UTSW 1 4,112,212 (GRCm39) missense unknown
R6405:Rp1 UTSW 1 4,415,994 (GRCm39) missense probably damaging 1.00
R6445:Rp1 UTSW 1 4,296,840 (GRCm39) missense unknown
R6466:Rp1 UTSW 1 4,418,109 (GRCm39) missense probably benign 0.01
R6501:Rp1 UTSW 1 4,381,503 (GRCm39) intron probably benign
R6547:Rp1 UTSW 1 4,240,528 (GRCm39) missense unknown
R6604:Rp1 UTSW 1 4,089,351 (GRCm39) missense unknown
R6700:Rp1 UTSW 1 4,420,119 (GRCm39) missense probably damaging 1.00
R6706:Rp1 UTSW 1 4,212,887 (GRCm39) missense unknown
R6831:Rp1 UTSW 1 4,420,087 (GRCm39) splice site probably null
R6918:Rp1 UTSW 1 4,069,831 (GRCm39) missense unknown
R6973:Rp1 UTSW 1 4,422,217 (GRCm39) nonsense probably null
R6981:Rp1 UTSW 1 4,415,878 (GRCm39) missense probably benign 0.06
R7078:Rp1 UTSW 1 4,277,014 (GRCm39) missense unknown
R7112:Rp1 UTSW 1 4,419,241 (GRCm39) missense probably benign 0.43
R7135:Rp1 UTSW 1 4,418,391 (GRCm39) missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4,420,140 (GRCm39) missense probably damaging 0.99
R7199:Rp1 UTSW 1 4,417,513 (GRCm39) missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4,298,824 (GRCm39) missense unknown
R7367:Rp1 UTSW 1 4,418,221 (GRCm39) missense probably benign 0.42
R7484:Rp1 UTSW 1 4,415,704 (GRCm39) missense probably benign 0.10
R7500:Rp1 UTSW 1 4,381,501 (GRCm39) missense unknown
R7569:Rp1 UTSW 1 4,355,063 (GRCm39) missense unknown
R7642:Rp1 UTSW 1 4,218,054 (GRCm39) missense unknown
R7693:Rp1 UTSW 1 4,417,626 (GRCm39) missense probably damaging 1.00
R7742:Rp1 UTSW 1 4,240,457 (GRCm39) missense unknown
R7759:Rp1 UTSW 1 4,415,107 (GRCm39) missense probably benign
R7784:Rp1 UTSW 1 4,212,881 (GRCm39) missense unknown
R7816:Rp1 UTSW 1 4,417,926 (GRCm39) missense probably damaging 0.98
R7866:Rp1 UTSW 1 4,417,924 (GRCm39) missense probably benign 0.02
R8215:Rp1 UTSW 1 4,315,318 (GRCm39) missense unknown
R8281:Rp1 UTSW 1 4,418,139 (GRCm39) missense probably damaging 1.00
R8294:Rp1 UTSW 1 4,416,220 (GRCm39) missense probably benign 0.09
R8309:Rp1 UTSW 1 4,417,312 (GRCm39) missense probably benign 0.00
R8311:Rp1 UTSW 1 4,418,572 (GRCm39) missense probably benign 0.11
R8500:Rp1 UTSW 1 4,416,813 (GRCm39) missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4,419,784 (GRCm39) missense probably damaging 1.00
R8672:Rp1 UTSW 1 4,419,007 (GRCm39) missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4,416,628 (GRCm39) missense probably benign 0.01
R8792:Rp1 UTSW 1 4,095,091 (GRCm39) missense unknown
R8859:Rp1 UTSW 1 4,420,183 (GRCm39) missense probably benign 0.07
R8945:Rp1 UTSW 1 4,419,817 (GRCm39) missense probably benign 0.42
R8959:Rp1 UTSW 1 4,419,650 (GRCm39) intron probably benign
R8979:Rp1 UTSW 1 4,218,937 (GRCm39) missense unknown
R9126:Rp1 UTSW 1 4,417,136 (GRCm39) missense probably damaging 0.99
R9156:Rp1 UTSW 1 4,234,161 (GRCm39) missense unknown
R9160:Rp1 UTSW 1 4,416,720 (GRCm39) missense probably benign 0.00
R9221:Rp1 UTSW 1 4,315,266 (GRCm39) missense unknown
R9263:Rp1 UTSW 1 4,419,160 (GRCm39) missense probably benign 0.02
R9263:Rp1 UTSW 1 4,418,675 (GRCm39) missense probably benign 0.25
R9302:Rp1 UTSW 1 4,416,789 (GRCm39) missense probably damaging 1.00
R9318:Rp1 UTSW 1 4,418,488 (GRCm39) missense probably benign 0.09
R9414:Rp1 UTSW 1 4,313,841 (GRCm39) missense unknown
R9474:Rp1 UTSW 1 4,162,838 (GRCm39) critical splice donor site probably null
R9478:Rp1 UTSW 1 4,417,545 (GRCm39) missense probably benign 0.06
R9529:Rp1 UTSW 1 4,416,447 (GRCm39) missense probably benign
R9572:Rp1 UTSW 1 4,418,662 (GRCm39) missense probably benign
R9673:Rp1 UTSW 1 4,337,792 (GRCm39) missense unknown
R9709:Rp1 UTSW 1 4,112,255 (GRCm39) missense unknown
R9716:Rp1 UTSW 1 4,212,833 (GRCm39) critical splice donor site probably null
RF003:Rp1 UTSW 1 4,414,917 (GRCm39) missense probably damaging 0.99
V1662:Rp1 UTSW 1 4,419,783 (GRCm39) missense probably damaging 1.00
X0012:Rp1 UTSW 1 4,417,918 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTACATACCCGGAAGTGGC -3'
(R):5'- GCACCTCACTTGAGTTTAGAACATC -3'

Sequencing Primer
(F):5'- AAGTGGCCCTCTGTGTGC -3'
(R):5'- GGGAATGATTTTCATTTCCCTT -3'
Posted On 2019-05-13