Incidental Mutation 'R7009:Ptprc'
ID544870
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R7009 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138064553 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1140 (H1140Y)
Ref Sequence ENSEMBL: ENSMUSP00000138800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
Predicted Effect probably damaging
Transcript: ENSMUST00000182283
AA Change: H1140Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: H1140Y

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182755
AA Change: H1116Y

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: H1116Y

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: H1279Y

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
bletchley UTSW 1 138117862 missense probably benign
Blush UTSW 1 138117720 intron probably benign
bruise UTSW 1 138064771 missense probably damaging 1.00
chor_muang UTSW 1 138113562 critical splice donor site probably null
crystal UTSW 1 138072255 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
Gentian UTSW 1 138067885 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
mauve UTSW 1 138099685 missense probably benign
Perverse UTSW 1 138101044 missense probably benign 0.02
ultra UTSW 1 138078445 critical splice donor site probably null
violaceous UTSW 1 138083639 missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
R6995:Ptprc UTSW 1 138088744 missense probably damaging 1.00
R7041:Ptprc UTSW 1 138126309 missense probably benign 0.04
R7055:Ptprc UTSW 1 138089571 missense probably damaging 1.00
R7098:Ptprc UTSW 1 138099685 missense probably benign
R7164:Ptprc UTSW 1 138117862 missense probably benign
R7188:Ptprc UTSW 1 138071180 missense probably damaging 1.00
R7191:Ptprc UTSW 1 138101044 missense probably benign 0.02
R7204:Ptprc UTSW 1 138117862 missense probably benign
R7316:Ptprc UTSW 1 138064771 missense probably damaging 1.00
R7644:Ptprc UTSW 1 138067907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTATACAGTGGCAAAGGTGAACAC -3'
(R):5'- CAGGAGCAATACCAGTTCCTC -3'

Sequencing Primer
(F):5'- TGGCAAAGGTGAACACAGATTCC -3'
(R):5'- GGAGCAATACCAGTTCCTCTATGAC -3'
Posted On2019-05-13