Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Sec16a'

544873

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 26436002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 240 (S240*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

AlphaFold

E9QAT4

Predicted Effect

probably null
Transcript: ENSMUST00000091252
AA Change: S1221*

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: S1221*

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114082
AA Change: S1221*

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: S1221*

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000153996
AA Change: S240*

SMART Domains

Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924
AA Change: S240*

Domain	Start	End	E-Value	Type
low complexity region	12	29	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
low complexity region	154	170	N/A	INTRINSIC
low complexity region	205	215	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1501:Sec16a	UTSW	2	26440045	missense	probably benign	0.16
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1959:Sec16a	UTSW	2	26430132	missense	probably benign	0.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2073:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26429393	missense	probably damaging	1.00
R4627:Sec16a	UTSW	2	26431068	splice site	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5391:Sec16a	UTSW	2	26440032	missense	possibly damaging	0.82
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6657:Sec16a	UTSW	2	26425864	nonsense	probably null
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6970:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
R7981:Sec16a	UTSW	2	26421372	critical splice donor site	probably null
R8117:Sec16a	UTSW	2	26441429	missense	probably benign	0.00
R8131:Sec16a	UTSW	2	26410946	missense
R8163:Sec16a	UTSW	2	26416421	missense
R8825:Sec16a	UTSW	2	26423574	missense
R8855:Sec16a	UTSW	2	26439840	missense	probably benign	0.16
R9165:Sec16a	UTSW	2	26423633	missense
R9216:Sec16a	UTSW	2	26414389	missense
R9283:Sec16a	UTSW	2	26423892	missense
R9506:Sec16a	UTSW	2	26429372	critical splice donor site	probably null
R9581:Sec16a	UTSW	2	26438635	missense
R9772:Sec16a	UTSW	2	26439405	missense	possibly damaging	0.87
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99
Z1176:Sec16a	UTSW	2	26438748	missense
Z1177:Sec16a	UTSW	2	26439321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTTGCTCATGCTGACATCATGG -3'
(R):5'- TTCAATGAGAGAATCCTGCCAC -3'

Sequencing Primer
(F):5'- CTCATGCTGACATCATGGGTTTG -3'
(R):5'- CACAATACTGCTCTTGGACAGTGG -3'

Posted On

2019-05-13